ID: 1140041894

View in Genome Browser
Species Human (GRCh38)
Location 16:71413599-71413621
Sequence AAATGGTGGCAGGAGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140041885_1140041894 8 Left 1140041885 16:71413568-71413590 CCAGAGGTGGGCCTGGGCACAAG No data
Right 1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG No data
1140041876_1140041894 23 Left 1140041876 16:71413553-71413575 CCCTGCTCCTCCAACCCAGAGGT No data
Right 1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG No data
1140041880_1140041894 16 Left 1140041880 16:71413560-71413582 CCTCCAACCCAGAGGTGGGCCTG No data
Right 1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG No data
1140041889_1140041894 -3 Left 1140041889 16:71413579-71413601 CCTGGGCACAAGAGGGCAGGAAA No data
Right 1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG No data
1140041883_1140041894 13 Left 1140041883 16:71413563-71413585 CCAACCCAGAGGTGGGCCTGGGC No data
Right 1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG No data
1140041877_1140041894 22 Left 1140041877 16:71413554-71413576 CCTGCTCCTCCAACCCAGAGGTG No data
Right 1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG No data
1140041884_1140041894 9 Left 1140041884 16:71413567-71413589 CCCAGAGGTGGGCCTGGGCACAA No data
Right 1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140041894 Original CRISPR AAATGGTGGCAGGAGTTTGG TGG Intergenic
No off target data available for this crispr