ID: 1140042572

View in Genome Browser
Species Human (GRCh38)
Location 16:71418172-71418194
Sequence TGGGCTTCAGCTGAGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140042566_1140042572 -9 Left 1140042566 16:71418158-71418180 CCCAGCCTAGTGCCTGGGCTTCA No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042557_1140042572 21 Left 1140042557 16:71418128-71418150 CCCAAAGACCTCACCCCCAGCTT No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042563_1140042572 5 Left 1140042563 16:71418144-71418166 CCAGCTTTTGCAGACCCAGCCTA No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042567_1140042572 -10 Left 1140042567 16:71418159-71418181 CCAGCCTAGTGCCTGGGCTTCAG No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042562_1140042572 6 Left 1140042562 16:71418143-71418165 CCCAGCTTTTGCAGACCCAGCCT No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042560_1140042572 8 Left 1140042560 16:71418141-71418163 CCCCCAGCTTTTGCAGACCCAGC No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042558_1140042572 20 Left 1140042558 16:71418129-71418151 CCAAAGACCTCACCCCCAGCTTT No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042561_1140042572 7 Left 1140042561 16:71418142-71418164 CCCCAGCTTTTGCAGACCCAGCC No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042559_1140042572 13 Left 1140042559 16:71418136-71418158 CCTCACCCCCAGCTTTTGCAGAC No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data
1140042556_1140042572 22 Left 1140042556 16:71418127-71418149 CCCCAAAGACCTCACCCCCAGCT No data
Right 1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140042572 Original CRISPR TGGGCTTCAGCTGAGAGGCT GGG Intergenic
No off target data available for this crispr