ID: 1140042739

View in Genome Browser
Species Human (GRCh38)
Location 16:71419773-71419795
Sequence CAGGGTAAACATACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140042736_1140042739 -5 Left 1140042736 16:71419755-71419777 CCAACTTGAGACACATTTCAGGG No data
Right 1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG No data
1140042734_1140042739 16 Left 1140042734 16:71419734-71419756 CCACAGAGAAAGTAGGTGCTACC No data
Right 1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140042739 Original CRISPR CAGGGTAAACATACAGAGGA AGG Intergenic
No off target data available for this crispr