ID: 1140043171

View in Genome Browser
Species Human (GRCh38)
Location 16:71422921-71422943
Sequence GGTCCAGAAGATTCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140043171_1140043178 1 Left 1140043171 16:71422921-71422943 CCCACTGTGGAATCTTCTGGACC No data
Right 1140043178 16:71422945-71422967 TGTTGGTGAAGTCATATCAGGGG No data
1140043171_1140043179 17 Left 1140043171 16:71422921-71422943 CCCACTGTGGAATCTTCTGGACC No data
Right 1140043179 16:71422961-71422983 TCAGGGGCCCCGTATACACAAGG No data
1140043171_1140043180 18 Left 1140043171 16:71422921-71422943 CCCACTGTGGAATCTTCTGGACC No data
Right 1140043180 16:71422962-71422984 CAGGGGCCCCGTATACACAAGGG No data
1140043171_1140043176 -1 Left 1140043171 16:71422921-71422943 CCCACTGTGGAATCTTCTGGACC No data
Right 1140043176 16:71422943-71422965 CCTGTTGGTGAAGTCATATCAGG No data
1140043171_1140043177 0 Left 1140043171 16:71422921-71422943 CCCACTGTGGAATCTTCTGGACC No data
Right 1140043177 16:71422944-71422966 CTGTTGGTGAAGTCATATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140043171 Original CRISPR GGTCCAGAAGATTCCACAGT GGG (reversed) Intergenic
No off target data available for this crispr