ID: 1140044294

View in Genome Browser
Species Human (GRCh38)
Location 16:71430496-71430518
Sequence AAGGTGACTTGGGAGTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140044284_1140044294 18 Left 1140044284 16:71430455-71430477 CCTAAGGCTCAGGTGGAGGACAG No data
Right 1140044294 16:71430496-71430518 AAGGTGACTTGGGAGTTCATAGG No data
1140044291_1140044294 -7 Left 1140044291 16:71430480-71430502 CCAGGTCTCAGGGATCAAGGTGA No data
Right 1140044294 16:71430496-71430518 AAGGTGACTTGGGAGTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140044294 Original CRISPR AAGGTGACTTGGGAGTTCAT AGG Intergenic
No off target data available for this crispr