ID: 1140044993

View in Genome Browser
Species Human (GRCh38)
Location 16:71434528-71434550
Sequence CTCTATGGCAAGCACCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140044985_1140044993 24 Left 1140044985 16:71434481-71434503 CCAGCTTGACAGCCAGGCTCAAT No data
Right 1140044993 16:71434528-71434550 CTCTATGGCAAGCACCAGGGTGG No data
1140044987_1140044993 12 Left 1140044987 16:71434493-71434515 CCAGGCTCAATAGCTGGCTCTCA No data
Right 1140044993 16:71434528-71434550 CTCTATGGCAAGCACCAGGGTGG No data
1140044984_1140044993 27 Left 1140044984 16:71434478-71434500 CCACCAGCTTGACAGCCAGGCTC No data
Right 1140044993 16:71434528-71434550 CTCTATGGCAAGCACCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140044993 Original CRISPR CTCTATGGCAAGCACCAGGG TGG Intergenic
No off target data available for this crispr