ID: 1140046485

View in Genome Browser
Species Human (GRCh38)
Location 16:71443164-71443186
Sequence GGATGGTCCCAGGACTCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046485_1140046495 13 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046485_1140046498 20 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046498 16:71443207-71443229 GCCTGAGGCTGAGAGGCCCAGGG No data
1140046485_1140046500 28 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046500 16:71443215-71443237 CTGAGAGGCCCAGGGTCACATGG No data
1140046485_1140046497 19 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046497 16:71443206-71443228 AGCCTGAGGCTGAGAGGCCCAGG No data
1140046485_1140046501 29 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046485_1140046494 5 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046494 16:71443192-71443214 CTATGCTGACCAGGAGCCTGAGG No data
1140046485_1140046488 -4 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046488 16:71443183-71443205 ATCCCCACCCTATGCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046485 Original CRISPR GGATGGTCCCAGGACTCTGA CGG (reversed) Intergenic
No off target data available for this crispr