ID: 1140046488

View in Genome Browser
Species Human (GRCh38)
Location 16:71443183-71443205
Sequence ATCCCCACCCTATGCTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046482_1140046488 15 Left 1140046482 16:71443145-71443167 CCTACGGAGAGGGAGAAAACCGT No data
Right 1140046488 16:71443183-71443205 ATCCCCACCCTATGCTGACCAGG No data
1140046485_1140046488 -4 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046488 16:71443183-71443205 ATCCCCACCCTATGCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046488 Original CRISPR ATCCCCACCCTATGCTGACC AGG Intergenic
No off target data available for this crispr