ID: 1140046489

View in Genome Browser
Species Human (GRCh38)
Location 16:71443185-71443207
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046489_1140046498 -1 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046498 16:71443207-71443229 GCCTGAGGCTGAGAGGCCCAGGG No data
1140046489_1140046501 8 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046489_1140046505 18 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046489_1140046497 -2 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046497 16:71443206-71443228 AGCCTGAGGCTGAGAGGCCCAGG No data
1140046489_1140046495 -8 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046489_1140046503 15 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046503 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
1140046489_1140046500 7 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046500 16:71443215-71443237 CTGAGAGGCCCAGGGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046489 Original CRISPR CTCCTGGTCAGCATAGGGTG GGG (reversed) Intergenic
No off target data available for this crispr