ID: 1140046491

View in Genome Browser
Species Human (GRCh38)
Location 16:71443187-71443209
Sequence GGCTCCTGGTCAGCATAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046491_1140046498 -3 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046498 16:71443207-71443229 GCCTGAGGCTGAGAGGCCCAGGG No data
1140046491_1140046503 13 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046503 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
1140046491_1140046495 -10 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046491_1140046500 5 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046500 16:71443215-71443237 CTGAGAGGCCCAGGGTCACATGG No data
1140046491_1140046501 6 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046491_1140046505 16 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046491_1140046497 -4 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046497 16:71443206-71443228 AGCCTGAGGCTGAGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046491 Original CRISPR GGCTCCTGGTCAGCATAGGG TGG (reversed) Intergenic