ID: 1140046493

View in Genome Browser
Species Human (GRCh38)
Location 16:71443191-71443213
Sequence CTCAGGCTCCTGGTCAGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046493_1140046501 2 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046493_1140046498 -7 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046498 16:71443207-71443229 GCCTGAGGCTGAGAGGCCCAGGG No data
1140046493_1140046506 30 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data
1140046493_1140046505 12 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046493_1140046497 -8 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046497 16:71443206-71443228 AGCCTGAGGCTGAGAGGCCCAGG No data
1140046493_1140046500 1 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046500 16:71443215-71443237 CTGAGAGGCCCAGGGTCACATGG No data
1140046493_1140046503 9 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046503 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046493 Original CRISPR CTCAGGCTCCTGGTCAGCAT AGG (reversed) Intergenic