ID: 1140046495

View in Genome Browser
Species Human (GRCh38)
Location 16:71443200-71443222
Sequence ACCAGGAGCCTGAGGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046491_1140046495 -10 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046486_1140046495 3 Left 1140046486 16:71443174-71443196 CCTGGGACCATCCCCACCCTATG No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046485_1140046495 13 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046487_1140046495 -4 Left 1140046487 16:71443181-71443203 CCATCCCCACCCTATGCTGACCA No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046490_1140046495 -9 Left 1140046490 16:71443186-71443208 CCCACCCTATGCTGACCAGGAGC No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data
1140046489_1140046495 -8 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046495 16:71443200-71443222 ACCAGGAGCCTGAGGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046495 Original CRISPR ACCAGGAGCCTGAGGCTGAG AGG Intergenic
No off target data available for this crispr