ID: 1140046496

View in Genome Browser
Species Human (GRCh38)
Location 16:71443201-71443223
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046496_1140046500 -9 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046500 16:71443215-71443237 CTGAGAGGCCCAGGGTCACATGG No data
1140046496_1140046505 2 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046496_1140046501 -8 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046496_1140046503 -1 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046503 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
1140046496_1140046506 20 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046496 Original CRISPR GCCTCTCAGCCTCAGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr