ID: 1140046499

View in Genome Browser
Species Human (GRCh38)
Location 16:71443208-71443230
Sequence ACCCTGGGCCTCTCAGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046499_1140046503 -8 Left 1140046499 16:71443208-71443230 CCTGAGGCTGAGAGGCCCAGGGT No data
Right 1140046503 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
1140046499_1140046506 13 Left 1140046499 16:71443208-71443230 CCTGAGGCTGAGAGGCCCAGGGT No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data
1140046499_1140046505 -5 Left 1140046499 16:71443208-71443230 CCTGAGGCTGAGAGGCCCAGGGT No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046499_1140046507 27 Left 1140046499 16:71443208-71443230 CCTGAGGCTGAGAGGCCCAGGGT No data
Right 1140046507 16:71443258-71443280 GATATCAGGTTATGTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046499 Original CRISPR ACCCTGGGCCTCTCAGCCTC AGG (reversed) Intergenic
No off target data available for this crispr