ID: 1140046501

View in Genome Browser
Species Human (GRCh38)
Location 16:71443216-71443238
Sequence TGAGAGGCCCAGGGTCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046487_1140046501 12 Left 1140046487 16:71443181-71443203 CCATCCCCACCCTATGCTGACCA No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046486_1140046501 19 Left 1140046486 16:71443174-71443196 CCTGGGACCATCCCCACCCTATG No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046489_1140046501 8 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046493_1140046501 2 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046490_1140046501 7 Left 1140046490 16:71443186-71443208 CCCACCCTATGCTGACCAGGAGC No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046491_1140046501 6 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046496_1140046501 -8 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046485_1140046501 29 Left 1140046485 16:71443164-71443186 CCGTCAGAGTCCTGGGACCATCC No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data
1140046492_1140046501 3 Left 1140046492 16:71443190-71443212 CCCTATGCTGACCAGGAGCCTGA No data
Right 1140046501 16:71443216-71443238 TGAGAGGCCCAGGGTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046501 Original CRISPR TGAGAGGCCCAGGGTCACAT GGG Intergenic
No off target data available for this crispr