ID: 1140046502

View in Genome Browser
Species Human (GRCh38)
Location 16:71443223-71443245
Sequence CCAATGTCCCATGTGACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046502_1140046507 12 Left 1140046502 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
Right 1140046507 16:71443258-71443280 GATATCAGGTTATGTCCTCTAGG No data
1140046502_1140046506 -2 Left 1140046502 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046502 Original CRISPR CCAATGTCCCATGTGACCCT GGG (reversed) Intergenic