ID: 1140046504

View in Genome Browser
Species Human (GRCh38)
Location 16:71443224-71443246
Sequence ACCAATGTCCCATGTGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046504_1140046506 -3 Left 1140046504 16:71443224-71443246 CCAGGGTCACATGGGACATTGGT No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data
1140046504_1140046507 11 Left 1140046504 16:71443224-71443246 CCAGGGTCACATGGGACATTGGT No data
Right 1140046507 16:71443258-71443280 GATATCAGGTTATGTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046504 Original CRISPR ACCAATGTCCCATGTGACCC TGG (reversed) Intergenic
No off target data available for this crispr