ID: 1140046505

View in Genome Browser
Species Human (GRCh38)
Location 16:71443226-71443248
Sequence AGGGTCACATGGGACATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046490_1140046505 17 Left 1140046490 16:71443186-71443208 CCCACCCTATGCTGACCAGGAGC No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046486_1140046505 29 Left 1140046486 16:71443174-71443196 CCTGGGACCATCCCCACCCTATG No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046491_1140046505 16 Left 1140046491 16:71443187-71443209 CCACCCTATGCTGACCAGGAGCC No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046499_1140046505 -5 Left 1140046499 16:71443208-71443230 CCTGAGGCTGAGAGGCCCAGGGT No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046489_1140046505 18 Left 1140046489 16:71443185-71443207 CCCCACCCTATGCTGACCAGGAG No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046492_1140046505 13 Left 1140046492 16:71443190-71443212 CCCTATGCTGACCAGGAGCCTGA No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046487_1140046505 22 Left 1140046487 16:71443181-71443203 CCATCCCCACCCTATGCTGACCA No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046496_1140046505 2 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data
1140046493_1140046505 12 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046505 16:71443226-71443248 AGGGTCACATGGGACATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046505 Original CRISPR AGGGTCACATGGGACATTGG TGG Intergenic
No off target data available for this crispr