ID: 1140046506

View in Genome Browser
Species Human (GRCh38)
Location 16:71443244-71443266
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046499_1140046506 13 Left 1140046499 16:71443208-71443230 CCTGAGGCTGAGAGGCCCAGGGT No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data
1140046496_1140046506 20 Left 1140046496 16:71443201-71443223 CCAGGAGCCTGAGGCTGAGAGGC No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data
1140046493_1140046506 30 Left 1140046493 16:71443191-71443213 CCTATGCTGACCAGGAGCCTGAG No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data
1140046502_1140046506 -2 Left 1140046502 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data
1140046504_1140046506 -3 Left 1140046504 16:71443224-71443246 CCAGGGTCACATGGGACATTGGT No data
Right 1140046506 16:71443244-71443266 GGTGGCAGATCTGAGATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046506 Original CRISPR GGTGGCAGATCTGAGATATC AGG Intergenic