ID: 1140046507 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:71443258-71443280 |
| Sequence | GATATCAGGTTATGTCCTCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140046499_1140046507 | 27 | Left | 1140046499 | 16:71443208-71443230 | CCTGAGGCTGAGAGGCCCAGGGT | No data | ||
| Right | 1140046507 | 16:71443258-71443280 | GATATCAGGTTATGTCCTCTAGG | No data | ||||
| 1140046502_1140046507 | 12 | Left | 1140046502 | 16:71443223-71443245 | CCCAGGGTCACATGGGACATTGG | No data | ||
| Right | 1140046507 | 16:71443258-71443280 | GATATCAGGTTATGTCCTCTAGG | No data | ||||
| 1140046504_1140046507 | 11 | Left | 1140046504 | 16:71443224-71443246 | CCAGGGTCACATGGGACATTGGT | No data | ||
| Right | 1140046507 | 16:71443258-71443280 | GATATCAGGTTATGTCCTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140046507 | Original CRISPR | GATATCAGGTTATGTCCTCT AGG | Intergenic | ||