ID: 1140046507

View in Genome Browser
Species Human (GRCh38)
Location 16:71443258-71443280
Sequence GATATCAGGTTATGTCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140046499_1140046507 27 Left 1140046499 16:71443208-71443230 CCTGAGGCTGAGAGGCCCAGGGT No data
Right 1140046507 16:71443258-71443280 GATATCAGGTTATGTCCTCTAGG No data
1140046502_1140046507 12 Left 1140046502 16:71443223-71443245 CCCAGGGTCACATGGGACATTGG No data
Right 1140046507 16:71443258-71443280 GATATCAGGTTATGTCCTCTAGG No data
1140046504_1140046507 11 Left 1140046504 16:71443224-71443246 CCAGGGTCACATGGGACATTGGT No data
Right 1140046507 16:71443258-71443280 GATATCAGGTTATGTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140046507 Original CRISPR GATATCAGGTTATGTCCTCT AGG Intergenic