ID: 1140047251

View in Genome Browser
Species Human (GRCh38)
Location 16:71449252-71449274
Sequence CCCTATCAGTGTAAGATGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140047251_1140047253 -7 Left 1140047251 16:71449252-71449274 CCACACATCTTACACTGATAGGG 0: 1
1: 0
2: 4
3: 31
4: 255
Right 1140047253 16:71449268-71449290 GATAGGGCTTCTCCCCACTGTGG 0: 1
1: 0
2: 24
3: 76
4: 258
1140047251_1140047257 17 Left 1140047251 16:71449252-71449274 CCACACATCTTACACTGATAGGG 0: 1
1: 0
2: 4
3: 31
4: 255
Right 1140047257 16:71449292-71449314 TTGTCTGATGTGTGATATAATGG 0: 1
1: 0
2: 1
3: 18
4: 235
1140047251_1140047258 18 Left 1140047251 16:71449252-71449274 CCACACATCTTACACTGATAGGG 0: 1
1: 0
2: 4
3: 31
4: 255
Right 1140047258 16:71449293-71449315 TGTCTGATGTGTGATATAATGGG 0: 1
1: 0
2: 0
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140047251 Original CRISPR CCCTATCAGTGTAAGATGTG TGG (reversed) Exonic
903437540 1:23362615-23362637 CCCTATGAGTGTGAGGAGTGTGG - Exonic
905750907 1:40462984-40463006 CCCTATGAATGTAAGGAGTGTGG + Exonic
905759936 1:40547215-40547237 CCCTACCAGTGTATCATATGTGG + Exonic
906065890 1:42979920-42979942 ACCTCTCAGTGTAAGAGCTGAGG + Intergenic
906902007 1:49845407-49845429 CCCTATGAGTGCAACAAGTGTGG + Intronic
909153340 1:72036885-72036907 ATATATCAGTGTAAAATGTGTGG + Intronic
909153438 1:72038895-72038917 TCATATCATTGTTAGATGTGAGG - Intronic
910450013 1:87335100-87335122 CCCTATTTTTGTAAGATGGGGGG - Intronic
915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG + Intergenic
916024707 1:160823628-160823650 GCCCATCAGTGGAAGATATGAGG + Exonic
921636062 1:217494912-217494934 TCCTATCAGTGTCACAAGTGAGG + Intronic
924766576 1:247037507-247037529 CCCTATGAATGTAAGAAATGTGG - Exonic
924773808 1:247100498-247100520 CCCTATGAATGTAAGAAATGCGG - Exonic
1063187379 10:3663641-3663663 CCCCATCTGTGGAAGGTGTGGGG - Intergenic
1063780375 10:9315711-9315733 CCCTATTAGTGAAAGATCAGAGG + Intergenic
1065310109 10:24407563-24407585 CCCTATCATTCTAAGATTTTAGG - Intronic
1066682876 10:37952203-37952225 CCCTATGAGTGTCAGGAGTGTGG - Exonic
1066682929 10:37952707-37952729 CCCTATGAGTGTAAGGAGTGTGG - Exonic
1066693361 10:38055358-38055380 CCCTATCAATGTAATGCGTGTGG + Exonic
1066999444 10:42593694-42593716 CCCTATCAGTGTAATGCATGTGG - Exonic
1067122145 10:43482658-43482680 CCCTATGAGTGTAAGGAATGTGG + Exonic
1067130191 10:43557106-43557128 CCCTATGAGTGTGAGGAGTGTGG - Exonic
1067136889 10:43617184-43617206 CCCTATCACTGTAAGAAATGTGG + Exonic
1067139447 10:43644456-43644478 CCTTATCAGTGCAAGGAGTGTGG - Exonic
1067300489 10:45003780-45003802 CCCTATCAGTGTGATGAGTGTGG + Exonic
1074423833 10:113333379-113333401 CCCTAAGAGTGGAAGAGGTGGGG + Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1076762108 10:132611078-132611100 CCCTGTCAGAGGAGGATGTGGGG + Intronic
1080151623 11:29057995-29058017 GCCTATCAGTGAAAAATTTGGGG - Intergenic
1080348991 11:31359745-31359767 CCCTACCTGTCTAAAATGTGGGG + Intronic
1088111222 11:106264330-106264352 CCCTATGAATGTAAGAAATGTGG + Intergenic
1088993831 11:114978502-114978524 CCCTATGGGTGGAGGATGTGTGG + Intergenic
1096671190 12:53199176-53199198 CTCTCTCAGTGTAAGATGGAGGG - Intronic
1098304565 12:69089803-69089825 TCCAATCAGTGGAAGAGGTGGGG - Intergenic
1102850921 12:116244165-116244187 CCCTATCATTGGAGGAAGTGAGG - Intronic
1107230448 13:38103925-38103947 CCCTTTCAGGGTAGGATCTGTGG - Intergenic
1107950618 13:45458306-45458328 CCCCAGCAGTGTATGATGGGAGG + Intergenic
1109247383 13:59971936-59971958 TGCTATCAGTGTAAAATGAGTGG - Intronic
1109830367 13:67778610-67778632 CCCTTTTAGAGTAAGGTGTGGGG - Intergenic
1114697535 14:24640969-24640991 CTCTATCAGTCTTAGAAGTGGGG + Intergenic
1114895211 14:26981051-26981073 CTCTATGAGTGTAAGCTGTGTGG + Intergenic
1116911579 14:50471817-50471839 CCCTATAAATGTAAGAAATGTGG + Intronic
1121241303 14:92431887-92431909 CCGTCTCAGTGTTAGAGGTGGGG + Intronic
1128984314 15:72208071-72208093 CACTCTCAGAGGAAGATGTGTGG - Intronic
1129053847 15:72805949-72805971 CCATATCAGTGTATGATGAGGGG + Intergenic
1130515270 15:84621528-84621550 CCCTATAAGTGTGGGGTGTGTGG + Exonic
1133077336 16:3289887-3289909 CCCTATCAGTGCAACATTTGCGG + Exonic
1135214415 16:20552476-20552498 TCCTATCAATGCAGGATGTGTGG - Intronic
1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG + Intronic
1137022831 16:35447025-35447047 CCCTATGAATGTAAGAAATGTGG - Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1139681069 16:68563712-68563734 CCCTATCAGTGTAGTCTCTGTGG + Exonic
1139681133 16:68564273-68564295 CCCTATCAATGTAATGTATGTGG + Exonic
1140047156 16:71448328-71448350 CCCTTTCAGTGTAAGGAGTGTGG - Exonic
1140047173 16:71448496-71448518 CCCTATCAATGTAAGGAATGTGG - Exonic
1140047192 16:71448664-71448686 CCCTATGAGTGTAATGAGTGTGG - Exonic
1140047218 16:71448916-71448938 CCCTATCAGTGTAAAGAGTGTGG - Exonic
1140047238 16:71449168-71449190 CCCTATCAGTGCAAGGAATGTGG - Exonic
1140047251 16:71449252-71449274 CCCTATCAGTGTAAGATGTGTGG - Exonic
1140050384 16:71475627-71475649 CCCTATGAGTGTAATGAGTGTGG - Exonic
1140050394 16:71475711-71475733 CCCTATGAGTGTAATGAGTGTGG - Exonic
1140050413 16:71475879-71475901 CCCTATCAGTGTGAGGAGTGTGG - Exonic
1142082282 16:88156398-88156420 CCCTTTCTGTGTATGGTGTGAGG + Intergenic
1143199980 17:5105981-5106003 CCCTATGAGTGTAATGAGTGTGG - Exonic
1143449367 17:7026797-7026819 CCGTATAAGTGTGAGACGTGCGG + Exonic
1144107920 17:12002873-12002895 GGATATCAGTGTAAGCTGTGTGG + Intergenic
1144601918 17:16623789-16623811 CCTTATCAGTGTAATGTGTGTGG - Exonic
1148070639 17:44906662-44906684 CCTGATCAGTCTAAGATGGGTGG - Intronic
1152380684 17:79941031-79941053 CACGATCTGTGTAAGCTGTGCGG - Exonic
1153192187 18:2553429-2553451 CCCTATCAGTGCAACATATCAGG + Intronic
1153886494 18:9472739-9472761 CCCAATCAGTCAGAGATGTGTGG + Intergenic
1157204643 18:45687821-45687843 CCCCATCAGTAGAAGGTGTGGGG + Intergenic
1161174738 19:2834622-2834644 CCCTATGAATGTAAGCAGTGTGG + Exonic
1161177389 19:2853416-2853438 CCCTATGAATGTAAGCAGTGTGG + Exonic
1161187795 19:2933886-2933908 CCCTATCAATGTAAAGAGTGTGG - Exonic
1161187839 19:2934306-2934328 CCCTATGAGTGTAAGGAGTGTGG - Exonic
1162234384 19:9295794-9295816 CCCTATGAATGTAAGAAATGTGG - Exonic
1162234490 19:9296718-9296740 CCCTATCAGTGCAAGGAATGTGG - Exonic
1162247396 19:9413348-9413370 CCCTATGAATGTAAGGAGTGCGG - Exonic
1162247456 19:9413936-9413958 CCCTTTGAATGTAAGATATGTGG - Exonic
1162247479 19:9414188-9414210 CCCTATGAGTGTAAGGAGTGTGG - Exonic
1162253483 19:9467298-9467320 CTCTATCAATGTAAGAAATGTGG - Exonic
1162260382 19:9528768-9528790 GCCTGTGAGTGTAAGATATGTGG - Exonic
1162265081 19:9566244-9566266 CCCTATAAATGTAAGGAGTGTGG - Exonic
1162270458 19:9610549-9610571 CCCTATCAGTGTAAGGAATGTGG - Exonic
1162275741 19:9653097-9653119 CCCTATCAGTGTAAGGAATGTGG - Exonic
1162280221 19:9690487-9690509 CACTATCAGTGTAAGGAATGTGG - Exonic
1162284003 19:9724297-9724319 CCCTATCAGTGTAACAAATGTGG - Intergenic
1162594549 19:11617503-11617525 CCTTATAAATGTAAGGTGTGTGG + Exonic
1162607581 19:11722437-11722459 CCCTATGAATGTAAGCAGTGTGG - Exonic
1162607623 19:11722941-11722963 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162614015 19:11781244-11781266 CCCTATGAATGTAAGCAGTGTGG + Exonic
1162614028 19:11781412-11781434 CCCTATAAGTGTAAACTATGTGG + Exonic
1162619717 19:11832191-11832213 CCTTATGAATGTAAGATATGTGG + Exonic
1162619720 19:11832275-11832297 CCCTATAAATGTAAGCAGTGTGG + Exonic
1162619731 19:11832359-11832381 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162619793 19:11832982-11833004 CCTTATAAATGTAAGATATGTGG + Exonic
1162619801 19:11833066-11833088 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162623964 19:11868294-11868316 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162623983 19:11868462-11868484 CCCTATGAATGTAAGAAATGTGG + Exonic
1162624009 19:11868812-11868834 CCCTATGAATGTAAGAAATGTGG + Exonic
1162628450 19:11905472-11905494 CCTTATGAATGTAAGATATGTGG + Intronic
1162628465 19:11905640-11905662 CCCTATGAGTGTAAGCAATGTGG + Intronic
1162628510 19:11906078-11906100 CCCTATGAGTGTAAGCAATGAGG + Intronic
1162629067 19:11911856-11911878 CCTTATAAATGTAAGATATGTGG + Intronic
1162629073 19:11911940-11911962 CCCTATGAGTGTAAGCAATGTGG + Intronic
1162629081 19:11912024-11912046 CCCTATGAGTGTAAGCAATGTGG + Intronic
1162633691 19:11949105-11949127 CCTTATAAATGTAAGATATGTGG + Exonic
1162633703 19:11949273-11949295 CCCTATGAGTGTAAGCAGTGTGG + Exonic
1162633748 19:11949711-11949733 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162633757 19:11949795-11949817 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162633767 19:11949879-11949901 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162633810 19:11950383-11950405 CCCTATCAATGTAAGCAGTGTGG + Exonic
1162637250 19:11979270-11979292 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162637264 19:11979352-11979374 CCCTATGAGTGTAAGGAATGTGG + Intergenic
1162637289 19:11979622-11979644 CCCTATGAGTGTAAGCAATGTGG + Intergenic
1162637313 19:11979790-11979812 CCCTATGAGTGTAAGGAATGTGG + Intergenic
1162637321 19:11979892-11979914 CCTTATAAATGTAAGATATGTGG + Intergenic
1162637328 19:11979976-11979998 CCCTATGAGTGTAAGCAATGTGG + Intergenic
1162637335 19:11980060-11980082 CCCTATGAGTGTAAGCAATGTGG + Intergenic
1162641677 19:12015080-12015102 CCCTATGAATGTAAGCAGTGTGG - Exonic
1162645173 19:12043863-12043885 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162645188 19:12044031-12044053 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162645203 19:12044199-12044221 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162645225 19:12044451-12044473 CCCTATGAGTGTAAGCTATGTGG - Exonic
1162645249 19:12044787-12044809 CCCTATGAATGTAAGCAGTGTGG - Exonic
1162645256 19:12044871-12044893 CCCTATGAATGTAAGCAGTGTGG - Exonic
1162649526 19:12076542-12076564 CCCTATGAATGTAAGCAGTGTGG + Exonic
1162649534 19:12076626-12076648 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162649585 19:12077208-12077230 CCCTATGAGTGTAAGCAGTGTGG + Exonic
1162649593 19:12077292-12077314 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162649614 19:12077544-12077566 CCCTATGAATGTAAGCAGTGTGG + Exonic
1162649738 19:12078756-12078778 CCCTATGAATGTAAGCTGCGTGG + Exonic
1162653759 19:12112796-12112818 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162653765 19:12112880-12112902 CGCTATAAGTGTAAGCAGTGTGG + Exonic
1162656248 19:12132816-12132838 CCATATGAGTGTAAGGTATGTGG - Exonic
1162656293 19:12133236-12133258 CCCTATGAATGTAAGCAGTGTGG - Exonic
1162656299 19:12133320-12133342 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162663179 19:12186961-12186983 CCATATAAATGTAAGGTGTGTGG + Exonic
1162663249 19:12187717-12187739 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162678439 19:12319081-12319103 CCCTATGAGTGTAAGCAATGCGG - Exonic
1162678467 19:12319417-12319439 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162685578 19:12380972-12380994 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162686636 19:12391370-12391392 CCTCATAAGTGTAAGATATGTGG - Exonic
1162686669 19:12391790-12391812 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162691020 19:12431564-12431586 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162694726 19:12465065-12465087 CCCTATCAGTGTAAGCAATGTGG - Exonic
1165297982 19:34943909-34943931 CCCTATGAATGTAAGGAGTGTGG + Exonic
1165298007 19:34944161-34944183 CCCTATGAATGTAAGGAGTGTGG + Exonic
1165298030 19:34944329-34944351 CCCTATGAGTGTAAGGAATGTGG + Exonic
1165298045 19:34944497-34944519 CCCTATGAGTGTAAGGAGTGTGG + Exonic
1165500177 19:36182860-36182882 CCCTATGAGTGTAAGGAATGTGG - Exonic
1165524330 19:36340789-36340811 CCCTATGAATGTAAGGAGTGTGG - Exonic
1165524363 19:36341125-36341147 CCCTATGAATGTAAGGAGTGTGG - Exonic
1165536280 19:36449116-36449138 CCCTATGAATGTAAGATATGTGG - Exonic
1165543611 19:36514226-36514248 CCTTATGAGTGTAAGGTCTGTGG - Exonic
1165546963 19:36546939-36546961 CCCTATGAATGTAAGGAGTGTGG - Exonic
1165555421 19:36627116-36627138 CCGTATCAGTGTAATGAGTGTGG + Exonic
1165556667 19:36639005-36639027 CCCTATGAGTGTAAGGAATGTGG - Exonic
1165567921 19:36747828-36747850 CCCTATGAATGTAAGACATGTGG - Exonic
1165567952 19:36748164-36748186 CCCTATGAATGTAAGACATGTGG - Exonic
1165567973 19:36748416-36748438 CCCTATCATTGTAAGGAATGTGG - Exonic
1165568039 19:36749256-36749278 CCCTATCACTGTAAGGAATGTGG - Exonic
1165568052 19:36749424-36749446 CCCTATCATTGTAAGGAATGTGG - Exonic
1165568073 19:36749676-36749698 CCCTATGATTGTAAGGAGTGTGG - Exonic
1165568106 19:36750096-36750118 CCCTATCATTGTAAGCAATGTGG - Exonic
1165582274 19:36877263-36877285 CCCTATGAGTGTAAGGAATGTGG + Exonic
1165582361 19:36878103-36878125 CCCTATGAATGTAAGGAGTGTGG + Exonic
1165594037 19:36996871-36996893 CCCTATAAGTGTAGGGAGTGTGG + Intronic
1165594113 19:36997543-36997565 CCCTACGAGTGTAAGGAGTGTGG + Intronic
1165597768 19:37024951-37024973 CCCTATGAATGTGAGAAGTGTGG - Intronic
1165608433 19:37128243-37128265 CCCTATCAATGTAAGGAATGTGG + Exonic
1165620504 19:37242741-37242763 CCCTATGAATGTAAGAAATGTGG + Exonic
1165664175 19:37612256-37612278 CCCTATGAATGTAAGGAGTGTGG + Exonic
1165666595 19:37635546-37635568 CCCTATGAATGTAAGGAGTGTGG - Exonic
1165669790 19:37665940-37665962 CCCTATGAATGTTAGATATGGGG - Intronic
1165670010 19:37669026-37669048 CCCTATCAGTGTAAAGAATGTGG - Exonic
1165670077 19:37670033-37670055 CCCTATGAATGTCAGATATGTGG - Exonic
1165677390 19:37738559-37738581 CCCTATGTGTGTAAGCAGTGTGG - Exonic
1165684163 19:37803780-37803802 CCCTATGAATGTAAGGAGTGTGG + Intronic
1166021462 19:40034499-40034521 CCCTATGAATGTAAGGAGTGTGG - Exonic
1166021534 19:40035255-40035277 CCCTATGAATGTAAGGAGTGTGG - Exonic
1166021605 19:40036011-40036033 CCATATCAATGTAAGGAGTGTGG - Exonic
1166025012 19:40074922-40074944 CCCTATGAATGTAAGGAGTGTGG - Exonic
1166576682 19:43847385-43847407 CCCTATGAGTGTAAGGAATGTGG + Exonic
1166582384 19:43913751-43913773 CCCTATCAATGTGAGGAGTGTGG - Exonic
1166582466 19:43914339-43914361 CCCTATAAGTGTGAGGAGTGTGG - Exonic
1166609417 19:44176850-44176872 CCCTATAAATGTGAGATATGTGG + Exonic
1166615011 19:44235901-44235923 CCCTATAAATGTAAGGAGTGTGG + Exonic
1166623521 19:44327911-44327933 CCGTATAAATGTGAGATGTGTGG - Exonic
1166628771 19:44386608-44386630 CCCTATAAGTGTAAGGCATGTGG - Exonic
1166633542 19:44429297-44429319 CCCTACCAGTGTGACAAGTGTGG - Exonic
1166638469 19:44473070-44473092 CCCTATAAGTGTAAGGCATGTGG + Intergenic
1167231436 19:48286783-48286805 CCCTATAAATGTAAGACATGTGG + Exonic
1167536843 19:50059110-50059132 CCCTATAAGTGTAAGGAATGTGG - Intergenic
1167536870 19:50059278-50059300 CCCTATGAATGTAAAGTGTGTGG - Intergenic
1167968187 19:53165855-53165877 CCTTACCAGTGTAATAAGTGTGG - Exonic
1167977151 19:53237753-53237775 CCATATCAATGTAATATATGTGG - Exonic
1168442696 19:56384215-56384237 CCCTACCAATGTAAGGTATGTGG - Exonic
1168442725 19:56384551-56384573 CCCTATCAGTGTAAGGAATGTGG - Exonic
1168531751 19:57135567-57135589 CCCTATCAGTGTAAGACATGTGG - Exonic
1168546463 19:57254514-57254536 TCCTATCAGTGTAACAGATGTGG + Exonic
1168655962 19:58128122-58128144 CCCTATGAGTGTAATCAGTGTGG - Exonic
1168673802 19:58261825-58261847 CCCTATGAGTGTGACCTGTGTGG + Exonic
1168673831 19:58262161-58262183 CCCTATGAGTGCAACCTGTGTGG + Exonic
927064887 2:19461196-19461218 CCCTATCAGTGTAAGTAGTTGGG - Intergenic
927858428 2:26542195-26542217 CCCTAGCAGGGTAAGCTGTCTGG - Intronic
930415463 2:51085356-51085378 CTCTATCAGTGTAACATTTTAGG + Intergenic
930731878 2:54735736-54735758 CCCTTTCAATGTAAGAAATGTGG + Intronic
934541847 2:95181846-95181868 CGCTATCAGTGTAACGAGTGTGG + Exonic
937769090 2:125697484-125697506 CCCTAACAGTGTGAGCTGCGTGG + Intergenic
939618597 2:144389914-144389936 CCCTATCAGTGTGATAAATGTGG - Exonic
941198129 2:162475506-162475528 ACATAACATTGTAAGATGTGTGG - Intronic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
1171873707 20:30551312-30551334 CCCTATAAGTGTAAGGCATGTGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1177585657 21:23091223-23091245 CCCTATAAATGTAAGAAATGTGG - Intergenic
1181566904 22:23744368-23744390 CCTTATCAGTGTAAGGAATGTGG - Exonic
953168619 3:40487537-40487559 CCCTATGAATGTAAGGAGTGTGG + Exonic
953168658 3:40487873-40487895 CCTTATGAGTGTAAGGAGTGCGG + Exonic
953172106 3:40516429-40516451 CCCTATGAATGTAAGGAGTGCGG + Exonic
953172141 3:40516765-40516787 CCTTATGAGTGTAAAGTGTGTGG + Exonic
953173951 3:40532302-40532324 CCCTTTAAGTGTAAGGAGTGTGG + Exonic
953173960 3:40532386-40532408 CCCTATGAATGTAAGGAGTGTGG + Exonic
953173988 3:40532638-40532660 CCTTATCAATGTAAGGAGTGTGG + Exonic
953173999 3:40532722-40532744 CCTTATGAATGTAAGGTGTGTGG + Exonic
953617020 3:44500199-44500221 CCCTATGAGTGTAATGAGTGTGG - Exonic
953625844 3:44570338-44570360 CCCTATGAGTGTAATGAGTGTGG + Exonic
953628888 3:44594422-44594444 CCCTATAAGTGTAAGGAGTGTGG + Exonic
953633610 3:44642487-44642509 CCTTATAAGTGTAAGGAGTGTGG + Exonic
953635442 3:44659864-44659886 CCCTATGAATGTGAGAAGTGTGG + Exonic
957188386 3:76973358-76973380 CTCTCTCAGGGTAAGATGTAAGG - Intronic
961040753 3:123676336-123676358 GCCTGACAGTGAAAGATGTGGGG - Intronic
961649584 3:128410734-128410756 GCCTCTCAGTGGGAGATGTGTGG - Intergenic
963055056 3:141179400-141179422 CCTTATCACTGGAACATGTGAGG - Intergenic
967255305 3:187585732-187585754 CCCTATTAGGGAAAGGTGTGTGG - Intergenic
970469353 4:16361148-16361170 CCCTATCAGTGTGATAAATGTGG - Intergenic
973960648 4:56106546-56106568 CCCTTTCAGTGTTAGCTATGTGG + Intergenic
975975470 4:80090603-80090625 TCCTCTCAGTGTCAGGTGTGGGG - Intronic
979723400 4:123930867-123930889 CCCTCTCACTGCAAGATGTCTGG - Intergenic
982463497 4:155701399-155701421 CACTATCATTGTAAGAGGGGAGG - Intronic
984108682 4:175581628-175581650 CCCTATGAGTGGAAGCTGGGTGG + Intergenic
989527167 5:42466948-42466970 CCCTATGAATATAAGAAGTGTGG - Intronic
989651435 5:43695438-43695460 CTTTATCAATGAAAGATGTGAGG + Intronic
990344496 5:54858123-54858145 CCCTATCAGTGTAAGGAATGTGG + Intergenic
998786709 5:145718861-145718883 CTTGATAAGTGTAAGATGTGAGG + Intronic
1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG + Intronic
1002393158 5:178931698-178931720 CCCTATAAGTGTAATGTATGTGG + Exonic
1002393174 5:178931866-178931888 CCCTATCAGTGTAAAGAGTGTGG + Exonic
1002393211 5:178932370-178932392 CCTTATGAGTGTATGGTGTGTGG + Exonic
1002393232 5:178932622-178932644 CCCTATCAGTGTAATGAATGCGG + Exonic
1002411348 5:179079831-179079853 CCGTATCAGTGTAATCAGTGTGG + Exonic
1005672040 6:28116236-28116258 CCCTATGAGTGTGATGTGTGTGG + Intergenic
1005675777 6:28153325-28153347 CCCTATCAGTGTAATGTGTGTGG + Exonic
1005675786 6:28153409-28153431 CGCTATCACTGTAAGGAGTGTGG + Exonic
1005679227 6:28189110-28189132 CTCTATCAGTGTCAAGTGTGTGG + Intergenic
1005682214 6:28218429-28218451 GCCTGACAGTGGAAGATGTGCGG - Intergenic
1005684934 6:28245192-28245214 CCCTATCAGTGTGACACATGTGG - Exonic
1005684963 6:28245441-28245463 CCATACCAGTGCAATATGTGTGG - Exonic
1005693108 6:28326485-28326507 CCCTATCAATGTAAGGAGTGTGG - Exonic
1005697636 6:28365941-28365963 CCGTATCAGTGCAGTATGTGTGG + Exonic
1005697663 6:28366187-28366209 CCCTATCAGTGTAATGCGTGTGG + Exonic
1010757800 6:79686952-79686974 CCCTTTCTGTGTCTGATGTGGGG + Intronic
1014520014 6:122430808-122430830 CCCTACCACAGTCAGATGTGAGG + Intronic
1020048671 7:5064738-5064760 CCCTATCAGTGTAGCGAGTGTGG + Exonic
1023721564 7:43100401-43100423 CCCTGTCACTGAAAGATGTAAGG - Intergenic
1024110922 7:46145682-46145704 CTTTATGAGTGTAAGGTGTGTGG + Intergenic
1029294831 7:99531875-99531897 CCTTATCAGTGTGATATCTGTGG + Exonic
1029357665 7:100064438-100064460 CCATATAAGTGTAAGGAGTGTGG + Exonic
1031436976 7:121744448-121744470 CCCTTTCAGTTTTCGATGTGTGG - Intergenic
1032120495 7:129151917-129151939 CCATCTCAGTGTATCATGTGAGG - Intronic
1032624664 7:133578223-133578245 CCCGATAAGTCTAAGATGAGAGG - Intronic
1034237248 7:149581945-149581967 CCTTATTAGTATAAGATGTATGG + Intergenic
1034362809 7:150515441-150515463 CCCTAACAGTGTAACATGTGGGG + Intronic
1035674799 8:1449133-1449155 CCCCATCAGGGGAAGATGAGAGG - Intergenic
1043482180 8:80664649-80664671 CCCTATCTGTGTGAGATCTTAGG + Intronic
1048985650 8:139733428-139733450 CCCTAGCAGGCTAAGATGTGGGG + Intronic
1049858717 8:144882416-144882438 CCCTATGAGTGTAATGAGTGTGG - Exonic
1049871058 8:144976846-144976868 CCCTATGAGTGTAATGAGTGTGG - Intergenic
1055507452 9:76962960-76962982 CCCTATCAGTGAAACACTTGAGG - Intergenic
1057635269 9:96758929-96758951 CCCTTTCAGTGTAATAAATGTGG - Exonic
1057640710 9:96818236-96818258 CCCTATCAATGTGAGGAGTGTGG - Exonic
1057704351 9:97386900-97386922 CCCAATGAGTCTAAGATGTAGGG + Intergenic
1059263015 9:112997196-112997218 CCCTATCAATGTACTAAGTGTGG - Intergenic
1060298102 9:122356639-122356661 CCCTAACACTGTATGATCTGGGG + Intergenic
1186696755 X:12042692-12042714 CCTAGTCAGTGAAAGATGTGTGG + Intergenic
1190088057 X:47413142-47413164 CCCTATCAGTGTAATGAATGTGG + Exonic
1190217386 X:48489027-48489049 CCCTGTCAGTGTGAGCTGGGAGG + Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1191101850 X:56738255-56738277 CACAATCAGTGTCAGAAGTGGGG - Intergenic
1191710540 X:64145871-64145893 CCCTATCAGTGTAAGAAATGTGG - Intergenic