ID: 1140048539

View in Genome Browser
Species Human (GRCh38)
Location 16:71459066-71459088
Sequence CTGTAGAACTGGACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140048539_1140048543 25 Left 1140048539 16:71459066-71459088 CCATCCTCAGTCCAGTTCTACAG 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1140048543 16:71459114-71459136 AAGCTACCAGAACCTTCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140048539 Original CRISPR CTGTAGAACTGGACTGAGGA TGG (reversed) Intronic
900943778 1:5817866-5817888 CTGTGGAGCTGGACAGATGAGGG - Intergenic
903854550 1:26328982-26329004 CTGCAGAACTGAGCTCAGGAGGG - Intronic
904774802 1:32900203-32900225 CTGGAGCACTGGACTGAGCCTGG + Intronic
905503187 1:38455525-38455547 CTGTCTATATGGACTGAGGATGG + Intergenic
905688508 1:39926001-39926023 CTGGAGATCTGGGCTGAGTAGGG + Intergenic
906938704 1:50236861-50236883 CAGTAGAACTGGTTTGATGATGG - Intergenic
910278972 1:85477364-85477386 CTGTAGAAAAGGCCTGAGGGCGG - Intronic
911631579 1:100189522-100189544 CTGTAGATCAGGACAGAGGTGGG + Exonic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
913168806 1:116213418-116213440 CTATAGAACTGAACTGAGCTGGG - Intergenic
913275357 1:117132440-117132462 CTGGAGCACTGGACTGGGGAGGG + Intergenic
913323961 1:117610203-117610225 CTGTAGAACTAGCCAGAGGCAGG - Intronic
917043056 1:170827810-170827832 GTGCAGGACTGGAGTGAGGAAGG + Intergenic
919942379 1:202297279-202297301 CTGCAGAACTGTTCTGAGGGGGG - Intronic
920181996 1:204137794-204137816 CTGGGGAACTGGACTGGGGTGGG - Intronic
920397536 1:205658200-205658222 CTCTAGGACTGGGCTGATGAAGG - Exonic
920496694 1:206459997-206460019 CTGTAGAGTGCGACTGAGGAGGG + Intronic
920971480 1:210746909-210746931 CTGCAGAATGGGACAGAGGAAGG + Intronic
921824284 1:219654431-219654453 CTGTAGAACTGGATTGACTTTGG + Intergenic
922077516 1:222262446-222262468 CTGAATAACTGGTGTGAGGAAGG + Intergenic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1064538297 10:16380433-16380455 CTGTAGTTCTAGGCTGAGGAAGG - Intergenic
1064672361 10:17729678-17729700 CTGTAGAAGTGGGCATAGGAAGG + Intergenic
1065882360 10:30047664-30047686 CTGCAGAACGGGCATGAGGATGG - Exonic
1066387610 10:34954439-34954461 TTGTAGAACTGAACTGGGGTTGG + Intergenic
1067948263 10:50705340-50705362 AGGAAGAACTTGACTGAGGATGG - Intergenic
1068227693 10:54127571-54127593 GTCTAGAAATGGAGTGAGGAAGG + Intronic
1069034262 10:63630638-63630660 CTCCAGAACTGGACCGAGGGCGG + Intergenic
1070883577 10:79870335-79870357 AGGAAGAACTTGACTGAGGATGG - Intergenic
1071650137 10:87386645-87386667 AGGAAGAACTTGACTGAGGATGG - Intergenic
1071915663 10:90292642-90292664 CTGAAAAGGTGGACTGAGGAAGG + Intergenic
1073355185 10:102848249-102848271 AGGTAGGACTGGACTCAGGAAGG - Intergenic
1073867910 10:107825960-107825982 CTGTAGGCCTGGACAGAGGGTGG + Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1077264262 11:1641312-1641334 CTGTAGGACTGGGCTGTGGCTGG + Intergenic
1077919802 11:6633573-6633595 CTGGAGATCGGGGCTGAGGACGG - Exonic
1083333807 11:61911599-61911621 CGGTGGACCCGGACTGAGGAGGG - Intronic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1083996145 11:66273682-66273704 GTGTAGACATGGACAGAGGAGGG - Intronic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1089682246 11:120125172-120125194 CTGTTGAGCTGGGCTGGGGACGG - Intronic
1090793890 11:130117396-130117418 CTGAAGAACTGAAATCAGGAGGG - Intronic
1091379404 12:46262-46284 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1091818926 12:3459835-3459857 CTTTAGAGCTGGGGTGAGGACGG + Intronic
1092572982 12:9745469-9745491 CTGTAAAACTGGAAAGAGGCTGG + Intergenic
1093235758 12:16606787-16606809 CTGCAGGAGTCGACTGAGGAAGG + Intronic
1093294195 12:17367598-17367620 CTGTACACCTTGACTGATGATGG - Intergenic
1095485607 12:42681257-42681279 CTGAGGAACAGGACTGGGGAAGG - Intergenic
1095759596 12:45814666-45814688 TTTTATAACTGGAATGAGGAGGG - Intronic
1096812460 12:54180178-54180200 CTGTAAGATTTGACTGAGGATGG - Intronic
1097583071 12:61481780-61481802 GTTTAGAACTGGGCTGAGGCTGG + Intergenic
1099475432 12:83103141-83103163 CTGTAGAAGTGACCTGAGGATGG + Intronic
1102682026 12:114697341-114697363 TTATGGAACTGGACGGAGGATGG + Intergenic
1103391794 12:120579513-120579535 TTGCAGAACTGCACTGATGAAGG - Exonic
1104213733 12:126715267-126715289 CTCTAAAACGGGAATGAGGAAGG + Intergenic
1105717398 13:23081099-23081121 CTCTAGCCCTGGAATGAGGAGGG - Intergenic
1106198680 13:27517027-27517049 CTGTCAAACTGGATTGGGGAGGG - Intergenic
1107698592 13:43024258-43024280 CTGTAGAGCTGGAAAAAGGAAGG + Intronic
1112295101 13:98179526-98179548 CTGTAGAAGTGGGCTGGGAAGGG + Intronic
1113823988 13:113236107-113236129 GTGCAGAACTGGACTCAGTAAGG + Intronic
1121869557 14:97394741-97394763 CTTTAGCACTGGCTTGAGGATGG + Intergenic
1122268221 14:100556612-100556634 CTGTAGGGCTGGGGTGAGGATGG - Intronic
1128509952 15:68307308-68307330 CTGCAGAACTGGGCTTAGGCCGG - Intronic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1130622277 15:85476132-85476154 CTTGAGGACTGGACTGAGCATGG + Intronic
1133110089 16:3542908-3542930 CTGTTGCCCTGGAGTGAGGAAGG - Intronic
1137552352 16:49447107-49447129 CTGTAGTACTGGAGTAAAGACGG - Intergenic
1139963020 16:70728727-70728749 CTGGAGAACTGGGCTGAGGTGGG - Intronic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1141883403 16:86874794-86874816 CTGGAGAACTGGACGTAGAAAGG + Intergenic
1142341478 16:89525813-89525835 CTGCAGCACGGGACTGAGGATGG - Intronic
1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG + Intronic
1145860423 17:28205165-28205187 CTGTAAAACTGGGCTAATGATGG + Intergenic
1147445937 17:40475371-40475393 CTGAAGAGCTGGACTGTGGTCGG - Intergenic
1150015700 17:61554483-61554505 CTGTAGTACTGGTGTCAGGATGG + Intergenic
1151293004 17:73164102-73164124 CTCTAAAACTGTACTGAGGATGG + Intergenic
1152768275 17:82152536-82152558 CTGTAGCACTGGAATGATGTGGG - Intronic
1153604294 18:6816404-6816426 CTGTGGAACTGGACTGTGCCAGG + Intronic
1156621390 18:38856019-38856041 CTGTAAAACTGAACTTATGAAGG + Intergenic
1156660802 18:39344189-39344211 CTGTAGAAGTGTACTCAGTATGG - Intergenic
1159176225 18:64838319-64838341 CAGTAAAACTGTAGTGAGGAAGG - Intergenic
1159405620 18:67998828-67998850 CTGTAGAGCTGGACTGGAGGTGG - Intergenic
1160449840 18:78955118-78955140 CTGCAGAAGTGGCCTGTGGAGGG - Intergenic
1162343773 19:10107941-10107963 CTGTAGGACAGGAGAGAGGAGGG - Intronic
1165803791 19:38568194-38568216 ATGTAGCTCTGGACAGAGGATGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1168075169 19:53977308-53977330 CTGCAGAACTGGACAGAGCTGGG + Intronic
926992045 2:18690450-18690472 CTGTAGAAGGGGTCTGAGTAGGG - Intergenic
931368077 2:61636742-61636764 CTGTAGAACTGGGCAGAAGGAGG + Intergenic
932355421 2:71064562-71064584 CTGTTGATCTGGGATGAGGAAGG - Intronic
933113299 2:78432130-78432152 CTGGAGAACTGGTCTGGGGAAGG + Intergenic
935024613 2:99264292-99264314 CTGTAGAACTGGGCTGAGCCAGG + Intronic
936014908 2:108950706-108950728 CCGGAGAACTGGACTCATGAAGG - Intronic
936564362 2:113571665-113571687 CAGGAGAGCTGGACAGAGGAAGG + Intergenic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
938976530 2:136483507-136483529 CTGTGGATCTGGTCTGAGCACGG + Intergenic
939441015 2:142249298-142249320 CTGCAGAACTACACAGAGGAGGG + Intergenic
942129571 2:172865044-172865066 GCCTACAACTGGACTGAGGAAGG - Intronic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
947356227 2:229298974-229298996 CAGTTGAACTGAACTGAGAAGGG - Intergenic
1170769028 20:19316313-19316335 CTGTAGAGCTGGAGTGAGAAGGG + Intronic
1172757874 20:37299944-37299966 CTGGAGAGCTGGGCTGAGGCTGG + Intronic
1173014665 20:39214392-39214414 CTGAAGATCTGAGCTGAGGAAGG + Intergenic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1177428445 21:20957304-20957326 CTGTTGAACTGGGCTGTAGAAGG + Intergenic
1179389608 21:40975709-40975731 CTGGAAAGCTGGACTGGGGAAGG + Intergenic
1181871773 22:25905139-25905161 CTGTTGAACTGAAGTGGGGATGG + Intronic
1184005654 22:41706556-41706578 CTGTTGAAGTGGACTGAGCATGG + Intronic
949666878 3:6349256-6349278 CAGTAGAACTGGTCCGAGGTTGG - Intergenic
950870308 3:16222699-16222721 CTTCAGAACTGCACGGAGGAAGG + Exonic
951448305 3:22807752-22807774 CTCCAGAGCTGGACTGTGGAAGG - Intergenic
952690892 3:36204340-36204362 CTGCAGAATTGGACTGAGCATGG - Intergenic
953712675 3:45287929-45287951 CTGCAGAACTGAATTGATGAGGG + Intergenic
954163851 3:48740503-48740525 CTGCAGAACTGCACTGAGCCAGG - Intergenic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955806399 3:62740078-62740100 CTGTTGACCTAGACTGAGCATGG + Intronic
955855895 3:63273138-63273160 CTGTAGAACTGAAGTAAAGATGG - Intronic
955946404 3:64198703-64198725 CTACAGAACTGGAATGAGGAAGG + Intronic
956674399 3:71720905-71720927 ATATAGAACTGGATGGAGGAGGG + Intronic
961596516 3:128022235-128022257 CTGCAGAGCTGGACTGAGGCTGG - Intergenic
962221314 3:133566663-133566685 AAATAGAACTGGACTGAGGGTGG - Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
963693463 3:148535056-148535078 CTGTAGAGTTGGATGGAGGAGGG + Intergenic
965397845 3:168182037-168182059 CAGAAGTGCTGGACTGAGGAAGG - Intergenic
966836822 3:184055815-184055837 ATGTAGAACTGGACTCACCATGG + Intronic
967099377 3:186203631-186203653 CTGCTGGACTGGATTGAGGAAGG + Intronic
970419084 4:15888364-15888386 CTGTAGAGCTGGAATGAGGGTGG - Intergenic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
971894747 4:32578336-32578358 CTCTGGAACTGAAATGAGGATGG - Intergenic
975559911 4:75699372-75699394 GGGTAGAACTGTGCTGAGGATGG - Intronic
976496427 4:85735022-85735044 ATGAAGAACTGGATTTAGGAAGG - Intronic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
985835394 5:2268189-2268211 CGGTGGAAATGCACTGAGGACGG - Intergenic
987055703 5:14189426-14189448 CTGTAGAATTGGATTGAGGAGGG + Intronic
987594286 5:19975920-19975942 CTTTAGCACTGGACTGAAAATGG + Intronic
989724858 5:44575945-44575967 CTATAGAACAGGACACAGGAAGG + Intergenic
992099209 5:73390053-73390075 CTCTAGAAGGGGACTAAGGATGG + Intergenic
994318398 5:98360817-98360839 CAGTAGACCTGGACAGAGCAGGG - Intergenic
995299459 5:110560779-110560801 CTGTAGATCTGGGCTCAGCATGG - Intronic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
997530172 5:134577110-134577132 CTGTAGACCTGGATGGAGGCTGG + Intronic
999202571 5:149826658-149826680 CTGTCAATCTGGAGTGAGGAGGG - Exonic
1000479987 5:161761139-161761161 CTCTAGAATTGGACTGTGGCAGG + Intergenic
1000973495 5:167739869-167739891 CTGGAAAACTGCACTGGGGATGG - Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1005993608 6:30918734-30918756 CAGTAGAACTGGAAAGGGGAAGG - Intronic
1010508636 6:76690265-76690287 CTGTACAACTCCACTGAGAAGGG - Intergenic
1010804079 6:80214165-80214187 TTGTAGAGCTGGAATGGGGAAGG + Intronic
1011633236 6:89347441-89347463 CTGTTGAACTGAACTGAGTAGGG - Intronic
1013426837 6:110019646-110019668 CTGGAGAGCTGAACTCAGGAGGG + Intergenic
1014371139 6:120609014-120609036 GGGTAGAACTGGAATGAGGAAGG - Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1016582816 6:145648322-145648344 CTGCAGAACTAGACTGACCAAGG - Intronic
1017391201 6:153941499-153941521 CTGCACAACTGGACTAAGTAGGG + Intergenic
1018508868 6:164503598-164503620 CAACAGAACTGGACTGAGGCTGG - Intergenic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1022029568 7:26479934-26479956 CTGGAAGACTGGACTGAGGCGGG + Intergenic
1022523711 7:31023871-31023893 CTGCAGACGTGGGCTGAGGAGGG + Intergenic
1022835574 7:34110613-34110635 CTGTACAAATGGATTTAGGATGG + Intronic
1023013575 7:35944027-35944049 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1024077553 7:45829807-45829829 CTGCAGAAGGGGCCTGAGGAGGG - Intergenic
1025126857 7:56351605-56351627 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1026019820 7:66698108-66698130 CTGAAGTACTGGTCTGAGGGTGG - Intronic
1026347973 7:69491419-69491441 CCGCAGAACTGAACTGATGAGGG + Intergenic
1026880544 7:73904460-73904482 CTGAAGTACTGGTCTGAGGGTGG + Intergenic
1028049037 7:86159257-86159279 GTGCAGAACTGGATGGAGGATGG + Intergenic
1028220408 7:88190079-88190101 GTGCAGAACTGAACTGAGGTTGG + Intronic
1029098043 7:98104917-98104939 CTGTAGTGCTGGCCTAAGGAAGG - Intergenic
1031324033 7:120369552-120369574 CTCTACATCTGGATTGAGGAAGG - Intronic
1031837034 7:126691003-126691025 CTGCAGAACTGGCCTGAAGGCGG + Intronic
1032526671 7:132583078-132583100 CTCTGGAACTGAACTGACGATGG - Intronic
1032527463 7:132590224-132590246 CTGAGGAAATGAACTGAGGAAGG + Intronic
1032534248 7:132648564-132648586 CTCTGGAGCTGGATTGAGGAGGG - Intronic
1033636003 7:143211700-143211722 TTGTAGAACTGGAGTAGGGAAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035239045 7:157518030-157518052 ATGTACAACTGGACTGGGGTTGG - Intergenic
1037594291 8:20341835-20341857 TTGTTAAACTGGAGTGAGGAGGG - Intergenic
1038075361 8:24067028-24067050 AGATAGAAATGGACTGAGGAGGG - Intergenic
1039080767 8:33732087-33732109 AAGTAGAAATTGACTGAGGAAGG + Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1045378536 8:101600169-101600191 ATGTAGAACAGGCCTGAGAAAGG + Intronic
1046029623 8:108768075-108768097 CTGGAGAACTGGAGTAAGGCTGG - Intronic
1046598446 8:116288798-116288820 ATGCAGAACTGGGCTGAGGACGG + Intergenic
1046743113 8:117849006-117849028 CTGTAGATGGTGACTGAGGATGG - Intronic
1048036922 8:130685653-130685675 CGATAGAACAGGACTGAGGAAGG - Intergenic
1048942363 8:139412479-139412501 TTGTAGATCTAGACAGAGGAGGG - Intergenic
1049888061 9:41543-41565 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1050611530 9:7359059-7359081 CTGCAGAACTGGCCTGGAGAGGG + Intergenic
1050980598 9:12008863-12008885 CTGTAGAACTGCAAGGTGGAAGG + Intergenic
1053606797 9:39668240-39668262 GTCTGGAACTGCACTGAGGATGG + Intergenic
1054246739 9:62674162-62674184 GTCTGGAACTGCACTGAGGATGG - Intergenic
1054560860 9:66708696-66708718 GTCTGGAACTGCACTGAGGATGG - Intergenic
1055866847 9:80824599-80824621 GTGTGGAACTGGCCTAAGGATGG + Intergenic
1058296223 9:103311412-103311434 CTGGAAAACTGGAATGAGAATGG - Intergenic
1058991378 9:110257247-110257269 CTGTAGAACGGGAATCATGATGG + Intergenic
1060123909 9:121023773-121023795 CTACAGGACTGGACTGAGGAAGG + Intronic
1061558935 9:131390239-131390261 CTGTTGAACTGGGCAGAGAAGGG - Intergenic
1062367132 9:136216139-136216161 CTGCTGATCTGGACTAAGGAGGG + Intronic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062491079 9:136805180-136805202 CTGCAGGGCTGGGCTGAGGAGGG + Intronic
1186416234 X:9385182-9385204 CTGTGGAACGGGACTGAAGCAGG + Intergenic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189684955 X:43554325-43554347 TTGTAGAAATGGACAGAGGTGGG - Intergenic
1196634822 X:117990306-117990328 CTGCTGAACTGAACTGAGTAAGG + Intronic
1196757125 X:119167677-119167699 CTGTCTAACTGGAGTCAGGAAGG + Intergenic
1200968888 Y:9128609-9128631 CTGAATAACTGTACTGAGTATGG - Intergenic
1202162785 Y:21952940-21952962 CTATGGAACTGGACTGAAGCAGG - Intergenic
1202228571 Y:22633428-22633450 CTATGGAACTGGACTGAAGCAGG + Intergenic
1202314586 Y:23562739-23562761 CTATGGAACTGGACTGAAGCAGG - Intergenic
1202556216 Y:26107856-26107878 CTATGGAACTGGACTGAAGCAGG + Intergenic