ID: 1140050888

View in Genome Browser
Species Human (GRCh38)
Location 16:71480086-71480108
Sequence TTGAAAAAGCATGAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 7, 3: 41, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140050888_1140050893 3 Left 1140050888 16:71480086-71480108 CCCAGCCCCTCATGCTTTTTCAA 0: 1
1: 0
2: 7
3: 41
4: 372
Right 1140050893 16:71480112-71480134 ACACCCTTCTCCCTCCCTGCTGG 0: 1
1: 0
2: 2
3: 39
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140050888 Original CRISPR TTGAAAAAGCATGAGGGGCT GGG (reversed) Intronic
900428600 1:2591800-2591822 GGGGAAAAGCATGAGGGGCAGGG - Intronic
901135289 1:6989040-6989062 TTGATAAGGCAGGAGGGGCAGGG + Intronic
901234273 1:7659237-7659259 TTGAAAAACTATCAGAGGCTGGG + Intronic
901572008 1:10168595-10168617 TAGAAAAAGCATAAGGTGCCGGG + Intronic
902283819 1:15393462-15393484 CTGTAAAAGGGTGAGGGGCTGGG + Intronic
902901325 1:19518308-19518330 TAGAAAATGAAAGAGGGGCTGGG + Intergenic
903143208 1:21352420-21352442 TTGAAAAAGAGTGAGGGGTCAGG + Intergenic
903613942 1:24638359-24638381 TTAAAAAAAAATAAGGGGCTGGG + Intronic
903761044 1:25699009-25699031 ATGAAGAAGCATGAAAGGCTGGG + Intronic
903961081 1:27058239-27058261 TGGGAAGAGCAGGAGGGGCTAGG - Intergenic
904306723 1:29594710-29594732 TCGACCAAGGATGAGGGGCTTGG + Intergenic
907765833 1:57409513-57409535 TTAAACCAGCATCAGGGGCTGGG + Intronic
908507704 1:64821990-64822012 TTTAAAAAGTATGAGAGGCCAGG + Intronic
908744113 1:67359203-67359225 TTGTAAAACAATGTGGGGCTGGG - Intronic
909692210 1:78421375-78421397 TTAAAAAAGCAGCAGGGGCTGGG - Intronic
910719108 1:90266030-90266052 AAGAAGAAGCTTGAGGGGCTGGG + Intergenic
910965787 1:92806774-92806796 ATGAAAAAGCAGGCTGGGCTTGG + Intergenic
913963116 1:143354215-143354237 TTGAAGATGCTTGAGGGCCTGGG + Intergenic
914057472 1:144179801-144179823 TTGAAGATGCTTGAGGGCCTGGG + Intergenic
914121674 1:144786565-144786587 TTGAAGATGCTTGAGGGCCTGGG - Intergenic
915948399 1:160171073-160171095 TGGAAAAAGGAGGAGGGGCTGGG + Intronic
915968690 1:160336048-160336070 TTTAAAAAGTATGACAGGCTGGG + Intronic
917225545 1:172777949-172777971 GTGAAAGAGCATGATTGGCTGGG - Intergenic
917851175 1:179065606-179065628 TTCACAAAGCATGAGGCGCCTGG - Intronic
921411772 1:214843626-214843648 TTGAAAAAGCTGGAGTGTCTTGG + Intergenic
921883761 1:220282584-220282606 AAGAGAAAGCATGAGGGGCTGGG + Intergenic
922477818 1:225918994-225919016 TTGAAAAGGCATGCGAGGCCGGG - Intronic
922941931 1:229474501-229474523 TTGAAAAAGAATGTGGGATTAGG + Intronic
924645232 1:245871606-245871628 GTGAAAAAGAATGCCGGGCTTGG + Intronic
1064421218 10:15192428-15192450 TTGTAAAAGAGAGAGGGGCTGGG - Intergenic
1064439129 10:15337599-15337621 TTTAATAAGCAGTAGGGGCTGGG + Intronic
1066274696 10:33857146-33857168 TTTATAATGCATCAGGGGCTGGG + Intergenic
1067541206 10:47155202-47155224 TTATAAAAGCATTATGGGCTGGG + Intergenic
1069550064 10:69357833-69357855 CTGGAGAAGGATGAGGGGCTTGG + Intronic
1070581993 10:77728121-77728143 TATAAAAAGCAGGAAGGGCTGGG - Intergenic
1072466887 10:95671889-95671911 TTAAAAAAACATGAGAGGCCAGG - Intronic
1072738321 10:97894691-97894713 ATGTAAAAGCATCAGGGGCTGGG - Intronic
1073200910 10:101734695-101734717 TTTAAAAAGCATGGGGGGCCGGG + Intergenic
1073403298 10:103276430-103276452 TTGGAGAAGCAGGAGGCGCTGGG - Intergenic
1074047427 10:109851470-109851492 TAGAAGAAACATCAGGGGCTAGG - Intergenic
1074605479 10:114960064-114960086 TTGCAAAAGCATGTATGGCTAGG + Intronic
1075720413 10:124582707-124582729 TAAGAAAAGCATAAGGGGCTGGG + Intronic
1076103806 10:127804213-127804235 TTTAAAAGGCACAAGGGGCTGGG + Intergenic
1076150482 10:128158304-128158326 TTGAAGAAGCAAGAGAGGATGGG - Intergenic
1076271934 10:129161295-129161317 TTGACAAAGCCTGAGGGGAAGGG - Intergenic
1076312135 10:129516141-129516163 TAAAAATAGCAAGAGGGGCTGGG - Intronic
1076768301 10:132649681-132649703 TTGAATAAGCATGCGTGGGTAGG + Intronic
1076844862 10:133065179-133065201 TTGAAAAGGCAAGTGGGGCTGGG - Intergenic
1077056843 11:597974-597996 TTGGACAAGCAGGAGGGTCTGGG + Intronic
1077109496 11:855867-855889 TTGGAATAGGATGGGGGGCTGGG - Intronic
1077180694 11:1212780-1212802 TTAAAAAACCATGATTGGCTGGG + Intergenic
1078634904 11:13040327-13040349 CTGAAAAAGGATAAGGGGCGGGG - Intergenic
1078883591 11:15477794-15477816 TTGAAAAGTCATTTGGGGCTAGG - Intergenic
1079346515 11:19657218-19657240 TGGAAAAAGCAGGAGAGGCTAGG + Intronic
1080849616 11:36056904-36056926 TTCAAAAGGCATGGGGGTCTTGG + Intronic
1081501428 11:43670317-43670339 TTTAAAAAGCATGATATGCTGGG - Intronic
1081847582 11:46251923-46251945 TTGAAAAGGCATCTGGGGGTGGG - Intergenic
1082116432 11:48334571-48334593 TTGGCAAAGCATGAGGGGTTTGG + Intergenic
1082257355 11:50045746-50045768 TTGGCAAAGCATGAGGGGTTTGG - Intergenic
1083487011 11:62989615-62989637 TAGAAAAAGCAAGCGGAGCTGGG + Intronic
1083589573 11:63885537-63885559 TTGAAAAAAAAAGAGAGGCTGGG + Intronic
1084728497 11:71058188-71058210 ATGAAAATGCATAAGAGGCTGGG - Intronic
1086375793 11:86199558-86199580 TTGAATAAACATGTTGGGCTAGG - Intergenic
1086402235 11:86470186-86470208 CTGAACAAACATGAGGGACTGGG + Intronic
1087205784 11:95392400-95392422 ATAAGAAAGCATGAGGGGCTGGG + Intergenic
1088673531 11:112167586-112167608 GTGAAATGGCCTGAGGGGCTAGG + Intronic
1089434387 11:118451785-118451807 ATTAAAAAGAATGAGAGGCTGGG - Intronic
1090280819 11:125454718-125454740 ATTAAGAAGCATGAGTGGCTGGG + Intronic
1090820194 11:130335164-130335186 TTTGAAAAGCATTTGGGGCTGGG + Intergenic
1091090994 11:132771179-132771201 TTCAAAAAGCACCAGGGTCTTGG + Intronic
1091149938 11:133318739-133318761 CTAAAAATTCATGAGGGGCTGGG + Intronic
1092805535 12:12218941-12218963 TTAAAAAACAATGTGGGGCTGGG + Intronic
1093315793 12:17648069-17648091 TTGAAAAAACATGAAAGACTTGG + Intergenic
1094676247 12:32622886-32622908 TTAAAAGAGCATGATAGGCTGGG - Intronic
1096173707 12:49496406-49496428 TTTAAAAAGCTTTAGGGGCCAGG - Intronic
1096276164 12:50210125-50210147 TTGAAAAACCAAAAGGGGCCGGG + Intronic
1096785119 12:54012918-54012940 TTGAGAAAGCATGCTGGCCTGGG + Intronic
1096858010 12:54499217-54499239 TTTAAAAAGCATGAGAGGCTGGG - Intronic
1097670942 12:62536983-62537005 TAAAAAACTCATGAGGGGCTGGG - Intronic
1098723431 12:73930828-73930850 TTCAAAAAGCATTTGTGGCTAGG - Intergenic
1099460861 12:82919197-82919219 GAGAAAAAGCATGAGGGGCTGGG + Intronic
1099597500 12:84686126-84686148 TTAAAAAATCATGTTGGGCTAGG + Intergenic
1099903957 12:88749743-88749765 TTGAAACAGCCTGATGAGCTTGG - Intergenic
1100026399 12:90134021-90134043 TGGAACATGCATGATGGGCTTGG - Intergenic
1100680892 12:96919381-96919403 TTAGAAAAGCCTGAGGGGCAAGG - Intronic
1101331605 12:103761893-103761915 TTGCAAAAGCATGAGGGGAGAGG + Intronic
1101775078 12:107786246-107786268 TTGAAAAGACATGACAGGCTGGG - Intergenic
1101959013 12:109234082-109234104 TTGGAGAAGGAGGAGGGGCTGGG + Intronic
1102406282 12:112676896-112676918 TTGAGGAAGAATGAGGGGCAAGG + Intronic
1102539542 12:113608744-113608766 TTCAAAAAGCATTAGATGCTGGG - Intergenic
1102560679 12:113760126-113760148 ATGATACAGCATGAGGGGCCGGG + Intergenic
1103081479 12:118027375-118027397 TTGGAAATGCATTTGGGGCTGGG + Intronic
1103691869 12:122781728-122781750 TTAAAAATGCATGTGAGGCTGGG + Intronic
1104490852 12:129191822-129191844 TTGGAAACTCATGAGGGGCAGGG + Intronic
1105378819 13:19867566-19867588 TTGAAAAAGCATGAGATGACTGG + Intergenic
1106078974 13:26484878-26484900 TTGAAAAATCATCAGGGGGCCGG + Intergenic
1106843788 13:33714846-33714868 TATAAAAAGCATGAGGTGGTTGG + Intergenic
1106941612 13:34786688-34786710 TTAAGAAAGAATGATGGGCTGGG + Intergenic
1108974703 13:56424315-56424337 TTGGAAATGCAGGAGGAGCTGGG + Intergenic
1109825277 13:67710975-67710997 TTGAAAAAGCCTGTGGAGCAAGG + Intergenic
1109878919 13:68445241-68445263 TAGAAAAAGCATAAAGGGCTTGG + Intergenic
1109960959 13:69629951-69629973 TTGAAAAAGATTGAGGAGCCAGG + Intergenic
1111671034 13:91330665-91330687 TTTAAAAAGCATAACAGGCTGGG - Intergenic
1114066505 14:19063237-19063259 TTTAAAAAATAAGAGGGGCTGGG - Intergenic
1114095761 14:19336787-19336809 TTTAAAAAATAAGAGGGGCTGGG + Intergenic
1114797607 14:25734398-25734420 TGGAAAAAGCAGGATAGGCTGGG - Intergenic
1116134371 14:40901678-40901700 TTGAAAAAACAATAGGGTCTAGG - Intergenic
1117477408 14:56110513-56110535 TTAAAAAAGAAGGAGGGGCCGGG + Intergenic
1118251552 14:64166648-64166670 TTTAAAAAGCATGTTAGGCTGGG + Intronic
1119440474 14:74624901-74624923 TTGAAAAAGGAACTGGGGCTGGG - Intergenic
1119718613 14:76876109-76876131 GTCAGAAAGCAGGAGGGGCTTGG - Intergenic
1119924219 14:78476487-78476509 TTTATAAACCATGAGGGGCTGGG + Intronic
1121028607 14:90637411-90637433 CTGTAAAACCATGTGGGGCTGGG - Intronic
1121152309 14:91646921-91646943 TTAAAAAATCATGAATGGCTGGG + Intronic
1121420976 14:93814019-93814041 AAGTAAAAGAATGAGGGGCTGGG + Intergenic
1122488796 14:102099261-102099283 TTAAAAATGCAGGAGAGGCTGGG + Intronic
1123887587 15:24742162-24742184 ATGTAGAAGCAAGAGGGGCTAGG - Intergenic
1125822403 15:42643489-42643511 TTTAAAAAGAACGAGGGGCCGGG - Intronic
1125840645 15:42798177-42798199 ATAAAAAAGAATGAGAGGCTGGG - Intronic
1126362354 15:47859458-47859480 TTCTAACAGAATGAGGGGCTTGG - Intergenic
1126551902 15:49940682-49940704 TGGAAAGAGAATAAGGGGCTAGG + Intronic
1126792808 15:52236376-52236398 TTGAAAATGCAGCAGAGGCTGGG + Intronic
1127888517 15:63226133-63226155 TTGACAAAGAATTAGTGGCTGGG - Intronic
1129109089 15:73327404-73327426 TAGAAAAAGCATCTGGGGCCGGG - Intronic
1129147507 15:73662229-73662251 TTTAAAACTGATGAGGGGCTGGG - Intergenic
1129372656 15:75107482-75107504 ATAAAAAAGAATGAAGGGCTGGG + Intronic
1129804319 15:78442189-78442211 TTAAAAAAGCAGGAGGGGCTGGG - Intronic
1129822834 15:78616456-78616478 TTGAAAGAGAATGAGGGTGTTGG - Intronic
1129908004 15:79203309-79203331 TGGAAAAAGGAGGAGGGGCCAGG + Intergenic
1130661305 15:85833469-85833491 AAGAAAAAGGATGACGGGCTTGG - Intergenic
1130889134 15:88118477-88118499 ATGGAAAACCAAGAGGGGCTGGG - Intronic
1131253956 15:90849167-90849189 GTCAAAAGGCATGAGGAGCTGGG - Intergenic
1131992894 15:98107878-98107900 TTGAAATATCAGGAGCGGCTGGG - Intergenic
1133725195 16:8530726-8530748 TTGGAAAAGAAGGAGGGGCCGGG + Intergenic
1133820443 16:9231563-9231585 TCAAAAAAGAAGGAGGGGCTGGG + Intergenic
1135052536 16:19204367-19204389 TTGGACAGGCATGGGGGGCTTGG + Intronic
1135273787 16:21092911-21092933 TTAAAAAACAATGAGTGGCTGGG + Intronic
1135636597 16:24081575-24081597 TTTTAAAGGCATGTGGGGCTCGG + Intronic
1137755160 16:50895593-50895615 TTGCAAAAGCCTGAGGAGATGGG + Intergenic
1137875975 16:51997170-51997192 TTTCAAAAACATGAAGGGCTTGG - Intergenic
1138079536 16:54076769-54076791 TTGAAAAGGCATGAAAGGCCAGG + Intronic
1138100765 16:54250340-54250362 TTGAAAAAGAATGAGGGCCGTGG + Intronic
1138290285 16:55840811-55840833 TTGAAAAAGCAATTTGGGCTGGG - Intergenic
1139712126 16:68783969-68783991 ATTAAAAATCATGAAGGGCTGGG - Intronic
1140050888 16:71480086-71480108 TTGAAAAAGCATGAGGGGCTGGG - Intronic
1140177303 16:72675577-72675599 TTAAAAATTCATTAGGGGCTGGG + Intergenic
1140672424 16:77292348-77292370 TGGAAAAATCATGAGGGCCTTGG - Intronic
1141537993 16:84696608-84696630 TTGTAAAACCATTAGAGGCTGGG + Intergenic
1142845558 17:2672772-2672794 TTGAAAAGGCATCAGCGGCCAGG + Intronic
1143505433 17:7362088-7362110 ATGAAAAAGCAGGAGGTGTTTGG + Intergenic
1143632145 17:8145617-8145639 CTTGAAAATCATGAGGGGCTGGG - Intronic
1144039801 17:11400432-11400454 TAGAACAAGGATGAGGGGCAAGG - Intronic
1144507399 17:15844126-15844148 TTAAAAAATCATCATGGGCTGGG + Intergenic
1144732129 17:17534434-17534456 TAGAAAGGGCAAGAGGGGCTGGG + Intronic
1145171524 17:20661731-20661753 TTAAAAAATCATCATGGGCTGGG + Intergenic
1145233674 17:21193402-21193424 ATGAAAAAGAAAGAGAGGCTGGG - Intergenic
1146008296 17:29176279-29176301 TTGAAAAAGTTTCAGTGGCTTGG + Intronic
1146294989 17:31642426-31642448 TTTAAAAAGCAAGACAGGCTGGG - Intergenic
1146661279 17:34666579-34666601 ATGGAAAAGCATGAGGAACTCGG - Intergenic
1147032683 17:37653061-37653083 ATAAAAAAGAATGAGGGGCCAGG + Intergenic
1147752105 17:42742436-42742458 TTGAAACAGCACTAGAGGCTGGG - Intronic
1148260829 17:46181725-46181747 TTAAAAAGGTGTGAGGGGCTGGG - Intronic
1149326003 17:55530487-55530509 TTAAAAATGCAGGAGAGGCTGGG + Intergenic
1149470222 17:56910356-56910378 TTGAAACATCATGAGCAGCTTGG - Intronic
1149585952 17:57786946-57786968 GTGAACTAGCATGAGAGGCTAGG - Intergenic
1149978752 17:61292353-61292375 TTGAAAAGAAATGAGGGGCCGGG + Intronic
1150290176 17:63976612-63976634 TTTGAGAAGCAAGAGGGGCTGGG - Intergenic
1150837705 17:68579384-68579406 TTGACCCAACATGAGGGGCTTGG + Intronic
1151045464 17:70915294-70915316 TTGAATAAGCATGATGGCTTAGG + Intergenic
1151274743 17:73025817-73025839 TTAAAAAAGGAAAAGGGGCTGGG + Intronic
1151984464 17:77533282-77533304 TTTAAAATGCAGGCGGGGCTGGG - Intergenic
1156103452 18:33627014-33627036 TTGAACTAGCAGGAGTGGCTGGG + Intronic
1158175524 18:54651712-54651734 TTTAAAAGGCATTAGAGGCTGGG - Intergenic
1158692124 18:59670113-59670135 TTCAGAAAGCAGGAGGGGGTGGG + Intronic
1158906574 18:62018919-62018941 TAGAAAAAGCATTGGAGGCTGGG + Intergenic
1159496914 18:69219005-69219027 CTGAAAATGTAGGAGGGGCTTGG + Intergenic
1159787188 18:72727900-72727922 GGGAAAAGGCATGTGGGGCTGGG - Intergenic
1160286513 18:77548326-77548348 TGGAAAAATCTTGAGGGGCAGGG - Intergenic
1162046378 19:8003090-8003112 TTGAAATAGCACCATGGGCTGGG + Intronic
1162197822 19:8999222-8999244 ATTAAAAGGCATCAGGGGCTGGG + Intergenic
1163478097 19:17538968-17538990 TTGAATAAACATGATGGTCTTGG + Intronic
1163748384 19:19061290-19061312 TTGGAAAAAGATGAGGGGCCTGG - Intergenic
1165024569 19:32950261-32950283 CTTAAAAAGCATTAGGGGCCAGG + Intronic
1165135220 19:33663573-33663595 TTTAAAAAGCAGGAGGGGCCAGG + Intronic
1165578560 19:36842708-36842730 TGAAAAAGACATGAGGGGCTGGG + Intronic
1166068673 19:40375267-40375289 TGGAAACAGGATGAGGGGCTTGG + Intronic
1166557173 19:43708000-43708022 CTGAAAAAACATGAAGGGCCAGG - Intergenic
1166628400 19:44382650-44382672 TTGAAGAAGCACCAGGGCCTGGG + Exonic
1167419686 19:49395585-49395607 ATGGAAAAGCAGGAGGGGCAAGG - Intronic
1167770559 19:51512973-51512995 TTGGAAAGGACTGAGGGGCTTGG + Intergenic
1167946176 19:52990953-52990975 TTTAAAAAGTATTATGGGCTGGG + Intergenic
1168662569 19:58179356-58179378 TTAAAAAAGCATATGGGGCCAGG + Intergenic
1202696954 1_KI270712v1_random:132474-132496 TTGAAGATGCTTGAGGGCCTGGG + Intergenic
925372023 2:3352699-3352721 AAGAAAAAGGATGAGTGGCTGGG + Intronic
925538759 2:4943746-4943768 TTGAATAAGCAGGAGTGGATGGG + Intergenic
925686338 2:6477219-6477241 AAGAGAAAGCATGAGAGGCTAGG + Intergenic
925930984 2:8707754-8707776 ATGAAAAAGAATGAGGGGTCTGG - Intergenic
926209405 2:10858129-10858151 TTAAAGAAACATGAGTGGCTGGG - Intergenic
927159538 2:20244011-20244033 TTGAGAAGGCATGAGGTCCTAGG - Intergenic
927164348 2:20301872-20301894 ATTAAAAAGAATGAGTGGCTGGG - Intronic
927561064 2:24074361-24074383 TTGAAAAAGCAACAGAGGCTGGG + Intronic
927767172 2:25821466-25821488 TTAAAAAAATATGCGGGGCTGGG + Intronic
927951746 2:27174977-27174999 TTGGAAGAGCAAGAGGGGGTGGG - Intergenic
928621111 2:33088858-33088880 TTGAAAATGCGTGACAGGCTGGG + Intronic
929933030 2:46273382-46273404 TGGAAAACGAATGAGGGCCTGGG - Intergenic
929933144 2:46274055-46274077 TGGAAAATGGATGAGGGCCTGGG + Intergenic
931452781 2:62382386-62382408 TGGAAACAGCCTGAGGGGATTGG + Intergenic
931994940 2:67830771-67830793 TTTAAAAAGCATGAATGGCTGGG - Intergenic
932088498 2:68783756-68783778 ATGAAAAAGCAAGGGAGGCTAGG - Intronic
932634681 2:73377997-73378019 TTGTAAAAACATTATGGGCTGGG - Intergenic
932897912 2:75661455-75661477 TTGAAAAACAAGCAGGGGCTGGG - Intronic
933675981 2:85058090-85058112 TTGAAAACCCATGTGGGGCCGGG + Exonic
934278114 2:91589488-91589510 TTGAAGATGCTTGAGGGCCTGGG + Intergenic
935302365 2:101703716-101703738 TTTAAAAATCATTAGGGGCCGGG + Intronic
936169056 2:110152157-110152179 TTAAAAACGCAAGAGGGGCTGGG + Intronic
936478716 2:112865308-112865330 TTCAAAAAACATGAGTGGCTTGG + Intergenic
937272277 2:120660753-120660775 TGGAAAGAGCATGGTGGGCTTGG - Intergenic
937652056 2:124330071-124330093 TCGAAATAGCATGAGGCTCTGGG + Intronic
937999955 2:127725439-127725461 TTAAAAAAGCAGCAGAGGCTGGG + Intronic
938289416 2:130141556-130141578 ATGAAACTGCATGAGAGGCTTGG + Intronic
938467114 2:131531382-131531404 ATGAAACTGCATGAGAGGCTTGG - Intronic
938483898 2:131683376-131683398 TTAAAAAAATAGGAGGGGCTGGG - Intergenic
938545197 2:132322547-132322569 TTGAAGAAGCACCAGGGCCTGGG - Intergenic
940156156 2:150659280-150659302 TTAAAAAAGGATGATTGGCTGGG - Intergenic
941703760 2:168635280-168635302 CTGAGGGAGCATGAGGGGCTTGG + Intronic
941856498 2:170236265-170236287 TTGAAAAAGCAAGGGGGGCTGGG + Intronic
941915581 2:170811367-170811389 CTGAACAAGCATAAGGCGCTGGG + Intergenic
941929574 2:170926564-170926586 ATGAAAAAACATGATCGGCTGGG + Intergenic
942842494 2:180379459-180379481 TTTAAAAACCAGGAAGGGCTAGG + Intergenic
943575593 2:189627358-189627380 TAAAAAATGCATGAAGGGCTAGG + Intergenic
944359896 2:198841494-198841516 TGGCAAGAGCATGAGGTGCTGGG + Intergenic
945189154 2:207168031-207168053 TTGAAATAGCATGGGGGTCAGGG - Intergenic
1169919108 20:10714755-10714777 ATTCAAAAGCATCAGGGGCTAGG + Intergenic
1170842133 20:19932592-19932614 TGGATCAAGCATGAAGGGCTTGG + Intronic
1172085014 20:32374588-32374610 TTCAAAAAGAATAAGGGGCCGGG - Intronic
1172107723 20:32526809-32526831 TTGAATGAGCATGAAGGGCTTGG + Intronic
1172243328 20:33428109-33428131 ATTAAAAAGAATGAGGGGCCGGG + Intronic
1173469461 20:43311529-43311551 TTGAAAAAGCCTAAGATGCTGGG + Intergenic
1173759844 20:45549840-45549862 ATGAAAAAGCAGGAGGTGCCAGG - Intergenic
1174773529 20:53323109-53323131 TGGAAAAAGCATGTTGGCCTGGG + Intronic
1179032080 21:37729617-37729639 TTAAAGAAGAATCAGGGGCTGGG - Intronic
1179138891 21:38705383-38705405 TTGAATAAGGATGAGATGCTGGG - Intergenic
1179462607 21:41547848-41547870 TTTAAAAAGCATGTGGGGCCAGG - Intergenic
1179648111 21:42787940-42787962 TAGAAAAAGCAGCAGGGACTTGG - Intergenic
1180215407 21:46320395-46320417 TTTAAAAGGCATCAGGGGCCAGG - Intronic
1181807039 22:25381212-25381234 TTGAAACAGTGTCAGGGGCTGGG - Intronic
1182135609 22:27899905-27899927 TAGAAAAAGCAGGAGAGGCCAGG + Intronic
1183362291 22:37388996-37389018 TGGGAGAAGCATGCGGGGCTTGG + Intronic
1184151371 22:42641148-42641170 TTTAAAAATCATAAGGGGCCGGG - Intronic
1184210397 22:43031921-43031943 TTTAAAATGCAAGAGAGGCTGGG + Intergenic
1185259820 22:49855239-49855261 TTGAAAAAGCTTCAGAGGCCCGG + Intronic
1185363749 22:50424933-50424955 TTGAAGAAGGAAAAGGGGCTGGG - Intronic
951594035 3:24297827-24297849 TTTAAAATGCATTATGGGCTGGG - Intronic
955405304 3:58622149-58622171 ATGAAAAAGCATTTAGGGCTGGG + Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
959032868 3:101322366-101322388 TAGAAAAAGCAAGAGGGTGTGGG + Intergenic
959051107 3:101525983-101526005 ATGAAAAAGCCTGAGTGGTTAGG + Intergenic
960851154 3:122056045-122056067 TTGAACATGCATGATGTGCTGGG + Intronic
961172910 3:124811594-124811616 GGGAAAAAGCAAGAGGGACTTGG + Intronic
961731283 3:128966863-128966885 TAGAAAAAGCATTCTGGGCTGGG - Exonic
962510935 3:136100053-136100075 TTGAAATATCATGATGGCCTTGG - Intronic
963001499 3:140685828-140685850 ATGAAAAAGCTTGAGGCCCTGGG - Intronic
963817361 3:149846599-149846621 TAGAAAATGAATAAGGGGCTGGG - Intronic
964683507 3:159368329-159368351 TGGAGAAAGCATGGGGAGCTAGG - Intronic
965503610 3:169485288-169485310 TTAAAAGAGCAAGAGCGGCTGGG - Intronic
966403245 3:179567876-179567898 TTGAATAAAAATGAGAGGCTGGG + Intronic
966532586 3:180997375-180997397 TTGGAAAAGCAGGAGTGACTTGG - Intergenic
967512654 3:190329937-190329959 TTGAAAAAGTATGATGGGGTTGG + Intronic
967544875 3:190713635-190713657 CTGAAACAGCATTGGGGGCTTGG + Intergenic
967835906 3:193962395-193962417 CTTTCAAAGCATGAGGGGCTAGG - Intergenic
970929903 4:21497371-21497393 TTGAAAAATCATGAGTTACTTGG - Intronic
971532357 4:27704782-27704804 TAGAAAAAGCAGGCAGGGCTGGG - Intergenic
972472244 4:39417588-39417610 TTAAAAAAGCATTTTGGGCTGGG - Intronic
972483760 4:39523345-39523367 TTTAAAAGTCATGAGGGGCCTGG - Intronic
972604822 4:40604327-40604349 ATGAAAAAGCATGATGGGCTGGG + Intronic
977582266 4:98738417-98738439 CTGAGAAAGCAAGAGGGGCCAGG - Intergenic
978623948 4:110663421-110663443 TTGAAAAAGCAAGGGGGGCGGGG + Intergenic
978916623 4:114132812-114132834 TTGAAGAAGCATGAGTCCCTGGG + Intergenic
979857297 4:125650482-125650504 TTGAAAAAGGGAGAGGGGCGTGG - Intergenic
980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG + Intergenic
981590992 4:146360750-146360772 TTTAAAAAGAAAGAGAGGCTGGG - Intronic
981844967 4:149157015-149157037 TTGAAGAAGTATCAGGGACTGGG + Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982862991 4:160477684-160477706 ATTAAAAAGCAACAGGGGCTGGG + Intergenic
983281062 4:165681291-165681313 CAGAAAAAGAATGAAGGGCTTGG + Intergenic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
983874863 4:172863764-172863786 TTGAAAAGGCATGATTGGTTTGG + Intronic
984819903 4:183872912-183872934 TTGAAAAACCATGAAGGCCATGG + Intronic
985311876 4:188611155-188611177 GGGAAAAAGCTTGAGGGGCTTGG - Intergenic
986853408 5:11839538-11839560 ATGCAAAATCATGAGTGGCTGGG + Intronic
987368072 5:17167749-17167771 ATGAAAAAGGATGAGGGGTGAGG + Intronic
988629009 5:32909456-32909478 TGGAAGAATCATGAGGAGCTTGG - Intergenic
988951074 5:36261140-36261162 TTGGAAAAGCAAAAGGGGTTGGG - Intronic
989392144 5:40912041-40912063 TTGAAGAAGTATGTGGGGCCGGG - Intronic
989659623 5:43786252-43786274 TTGAAAGAGGATGATGGGATTGG - Intergenic
990766985 5:59195009-59195031 AAGAGAAAACATGAGGGGCTGGG - Intronic
992127000 5:73652496-73652518 AGGAAATAGCATTAGGGGCTAGG + Intronic
992435276 5:76750216-76750238 ATGAAAAAATATAAGGGGCTGGG + Intergenic
993820162 5:92604422-92604444 TTGAAAAGGCATGAGGTCATTGG - Intergenic
993976619 5:94490487-94490509 TATAAAAAGAATGATGGGCTGGG + Intronic
994146604 5:96402359-96402381 TGGAAAGAACATGAGGGGCCAGG - Intronic
994784891 5:104145474-104145496 TTCAAAAAGCAAGAAGGGCTTGG - Intergenic
994803979 5:104419538-104419560 TTGGGAAAGCATGAGTGGCAGGG - Intergenic
997245456 5:132344729-132344751 ATGAAGCAGCATGAAGGGCTAGG + Intergenic
997401231 5:133604371-133604393 CTGAGAAAGCATTTGGGGCTAGG + Intronic
997481266 5:134186384-134186406 TCAAAAAGGCAGGAGGGGCTAGG + Intronic
997510030 5:134447811-134447833 TGGAAAAGGAATGAGGGGCTTGG - Intergenic
998455241 5:142267216-142267238 TTAAAGAAGCATGTTGGGCTGGG - Intergenic
998595572 5:143526503-143526525 TTAAAAAAGCCTGAGTGGCCGGG + Intergenic
999160733 5:149495499-149495521 TTAAAGAAGCAGGAGGGGCTGGG + Intronic
999174892 5:149625198-149625220 TTTAAAAAGCATTTGGGGCCAGG - Intronic
999574932 5:152965506-152965528 TTGAATATGAAGGAGGGGCTGGG - Intergenic
1000617585 5:163445751-163445773 TTAAAAAAACATTAGAGGCTAGG - Intronic
1002530894 5:179844255-179844277 TTGAAAAATGACCAGGGGCTGGG + Intronic
1003630262 6:7780250-7780272 TTTAAAAAGCAAGGGAGGCTGGG + Intronic
1004076618 6:12349718-12349740 TTTAAAAAGAATGAAGGGCAAGG - Intergenic
1004144176 6:13049120-13049142 TTGAAAAACCAAGAGTGGCAAGG - Intronic
1004254701 6:14052282-14052304 TTAAATAAGCATTATGGGCTAGG - Intergenic
1005247281 6:23902044-23902066 TTGAAAAATCATGAGGGACATGG + Intergenic
1005371301 6:25136535-25136557 ATCAAATAACATGAGGGGCTGGG + Intergenic
1005433123 6:25779432-25779454 TAGTAAAAGCATCAGGGGCTGGG + Exonic
1005439924 6:25856531-25856553 TTTAAAAACTTTGAGGGGCTGGG - Intronic
1005895649 6:30175241-30175263 TACAAAAAGCATTAGGGGCAAGG - Intergenic
1006117669 6:31783971-31783993 TTAAAAATGCACGAAGGGCTGGG + Intronic
1006252342 6:32798339-32798361 CTAACAAAGCATGAGCGGCTTGG + Intergenic
1006621193 6:35365433-35365455 AAAAAAAAGAATGAGGGGCTGGG - Intronic
1007681517 6:43636801-43636823 TTGAAAAAGCCAGAAGGGTTAGG - Intronic
1007826391 6:44604012-44604034 TTGAACATTCATTAGGGGCTGGG + Intergenic
1008826103 6:55696274-55696296 TTGAATGAGCCTGAGGGCCTGGG - Intergenic
1009826375 6:68870395-68870417 TTGAAAAATCAAGAGGAGCTTGG + Intronic
1010324909 6:74553325-74553347 TTGAGAAAGCATGAGCAGGTGGG - Intergenic
1011182275 6:84634266-84634288 AAGAGAAAGCATGAGGGACTGGG - Intergenic
1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG + Intergenic
1013308753 6:108873804-108873826 TGGAGAAAGCTTGAGGGGTTGGG - Intronic
1014619943 6:123654943-123654965 TTTAATAAGGATGAGGGCCTGGG + Intergenic
1014704089 6:124725397-124725419 TAAAAATAGCATAAGGGGCTGGG - Intronic
1015101986 6:129492230-129492252 TTAAAAAGGCATGCGGGGATTGG + Intronic
1015946377 6:138505358-138505380 TTGAAAATGAAACAGGGGCTGGG + Intronic
1016386090 6:143532200-143532222 TACAGAAAGCAAGAGGGGCTTGG + Intergenic
1016621241 6:146110979-146111001 TTCAAAAATCATGATTGGCTAGG + Intronic
1019555615 7:1629131-1629153 TTTAAAGAGCAGAAGGGGCTTGG + Intergenic
1019877017 7:3822472-3822494 TTTGAAAAGTATGTGGGGCTAGG + Intronic
1020155743 7:5722683-5722705 TTAAAAAAACATGAGAGGCTGGG - Intronic
1020365614 7:7377886-7377908 CAGAAGAAGAATGAGGGGCTTGG + Intronic
1020906065 7:14065954-14065976 TTAAAAAATGAAGAGGGGCTGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023513650 7:40979074-40979096 TGGAAAAGGCATGGGGGGCCAGG - Intergenic
1023709090 7:42973082-42973104 TTGAAAAATGATGAGGGGCTTGG - Intergenic
1024137627 7:46426861-46426883 ATGAAAAAGCCTCGGGGGCTAGG + Intergenic
1024698252 7:51878880-51878902 TTTAAAAAGCATCAGGGGTTGGG - Intergenic
1026963927 7:74427247-74427269 TAAAAATAGCAAGAGGGGCTGGG + Intergenic
1027003934 7:74675713-74675735 TTGAAAGAGAATGGGGGGCTGGG + Intronic
1027459997 7:78440398-78440420 ATGAGAAACCATGAGGGTCTGGG + Intronic
1027529809 7:79316098-79316120 TTCAAAAAGGATGGGGGGCCAGG + Intronic
1029070051 7:97888267-97888289 TTTAAAAAGAATAAGAGGCTGGG - Intergenic
1029126492 7:98298315-98298337 TTTAAAAAACATTAGGGGCTGGG + Intronic
1029631025 7:101750353-101750375 TTTAAAAGGCAGGAGGGGCTGGG + Intergenic
1029974689 7:104821994-104822016 TTACTAAAGCATGAGGAGCTTGG + Intronic
1032005935 7:128301930-128301952 CTGAAAATGCAAGAGGTGCTTGG + Exonic
1032369407 7:131331487-131331509 TTGAAAATGTAAGAGGGGCAGGG + Intronic
1034278653 7:149836555-149836577 TTGAGAAATCAGGAGGGTCTAGG - Intergenic
1034891297 7:154841509-154841531 TTGTAAAAGCCTTAGGGGTTAGG - Intronic
1035193312 7:157191591-157191613 TAGAAAACACACGAGGGGCTGGG - Intronic
1035311902 7:157974876-157974898 GTGAACATGCCTGAGGGGCTGGG - Intronic
1035663464 8:1363978-1364000 CTGACAGAGGATGAGGGGCTGGG - Intergenic
1035976856 8:4322698-4322720 TTGAAAATGCAGTAGGGGCCAGG + Intronic
1037087648 8:14872162-14872184 CTGACAGGGCATGAGGGGCTAGG + Intronic
1037447033 8:18975517-18975539 TGGATAAAGAATGAGGGACTTGG - Intronic
1037939863 8:22943382-22943404 TTAAAAAAACATGACTGGCTGGG - Intronic
1038047341 8:23776764-23776786 TTGGAAATGCATTAGGTGCTGGG + Intergenic
1038360109 8:26866825-26866847 TGGAAAAAGCGGGAGGCGCTGGG + Intronic
1038537942 8:28368015-28368037 TTGTAAATGCATGGGGCGCTGGG + Intronic
1038760796 8:30383627-30383649 TTGAAAAAGAAAGGGGGCCTGGG - Intergenic
1039007018 8:33050768-33050790 TTGAAAAAGAATTAGGTGTTTGG + Intergenic
1039300332 8:36202191-36202213 TTTAAAAAGAAATAGGGGCTGGG - Intergenic
1039795253 8:40907413-40907435 TTCAAGAGGTATGAGGGGCTGGG + Intergenic
1041338815 8:56820084-56820106 TTGAAAAATCATTATGTGCTAGG + Intergenic
1041452008 8:58015548-58015570 TTGAAAAGGCATGAGGGGCCGGG + Intronic
1042852905 8:73234462-73234484 TTGAAAAAGCCTGAGGAGTGGGG - Intergenic
1043160737 8:76843355-76843377 TTGAAAAGGGATTAGGTGCTGGG + Intronic
1043927361 8:86052379-86052401 TGGAAAAAGCATGAAGTCCTTGG + Intronic
1044111577 8:88281753-88281775 TTGAGAAAACATGGTGGGCTGGG - Intronic
1044718373 8:95122374-95122396 TTTAAAAAGCAAGCCGGGCTGGG - Intergenic
1044722368 8:95163235-95163257 TTTAGAGAGCATGAGGTGCTAGG + Intergenic
1044863621 8:96547657-96547679 ATGCAAAAGCATGAGCGTCTAGG + Intronic
1044991650 8:97801469-97801491 TTGAAAAATTATGAAGAGCTGGG - Intronic
1046291992 8:112174577-112174599 TTGAAGAAGCACTAGGTGCTGGG - Intergenic
1046399541 8:113686763-113686785 TTAAAAAAGCAGGCTGGGCTCGG - Intergenic
1048943638 8:139424950-139424972 ATGAAAAGGAATGAAGGGCTGGG + Intergenic
1049538289 8:143193166-143193188 TTGAAGCTGCATGAGGGGCGTGG + Intergenic
1052734568 9:32327662-32327684 TGGAGAAAGTATGAGTGGCTGGG - Intergenic
1053186416 9:36020255-36020277 TGGAAAAGGCAAGTGGGGCTAGG + Intergenic
1054793648 9:69278579-69278601 TTGAAAGAGGAAGTGGGGCTGGG - Intergenic
1056980282 9:91303620-91303642 TTTAAAAATCCTGTGGGGCTGGG - Intronic
1058716018 9:107722549-107722571 TTGAAAAAGAAGTAGGGGCCAGG - Intergenic
1059147965 9:111919202-111919224 TTAAAAAAGCATTAAAGGCTGGG + Intronic
1059724270 9:116990724-116990746 TTGTAAAAGAATGAGAGCCTTGG - Intronic
1059978180 9:119740414-119740436 TTGAAGAAGCATGAGTTCCTGGG - Intergenic
1061060694 9:128248895-128248917 TAGAAATATCATGAGGGGCTGGG + Intronic
1062173972 9:135150788-135150810 TTGAAGATGGAGGAGGGGCTTGG - Intergenic
1185810410 X:3103763-3103785 TGGAAAAGGCATGGGGGGCTGGG + Exonic
1186174911 X:6916170-6916192 TAGAAAAAGCATGAGTTGGTGGG - Intergenic
1186687775 X:11943528-11943550 AAGAGAAAGCATGAGGGGCTGGG + Intergenic
1188959988 X:36479377-36479399 CTGGAAACTCATGAGGGGCTAGG + Intergenic
1189149203 X:38687005-38687027 ATGAAAAGGTAGGAGGGGCTAGG - Intronic
1189303460 X:39969512-39969534 CTGAAAAATAAAGAGGGGCTGGG + Intergenic
1189307438 X:39997489-39997511 TTGCAAAAGGAAGAGGGGCCCGG - Intergenic
1189993829 X:46620123-46620145 TTAAGAAACCATGAGGGGTTGGG + Intronic
1190512628 X:51189520-51189542 AGGAAAAAGAATGAGGGTCTAGG - Intergenic
1192353737 X:70380005-70380027 TTTAAAAAGGATGATAGGCTGGG + Intronic
1192702131 X:73485719-73485741 TTCAAAAAGTTTTAGGGGCTGGG - Intergenic
1192909270 X:75585909-75585931 TAGAAAAAGTATTAAGGGCTGGG - Intergenic
1194303105 X:92210979-92211001 TTGAAACAGTTTGAAGGGCTCGG - Intronic
1195573565 X:106424040-106424062 TTGAAAGAGCATGATTTGCTAGG + Intergenic
1195629965 X:107044906-107044928 TTTAAAAAATATGAGTGGCTGGG - Intergenic
1197732145 X:129820282-129820304 TTAAAAAAGCATATTGGGCTGGG + Intronic
1197751307 X:129965623-129965645 TTGAAAAAGATAGAGGGGCAGGG - Intergenic
1198103417 X:133440926-133440948 TAGAGAAAGCAGGAGGGGATAGG + Intergenic
1198437335 X:136630035-136630057 TTGCAAAAACATGAGGTACTGGG + Intergenic
1201225195 Y:11811774-11811796 TAGAAAAGGCATGGGGAGCTTGG - Intergenic
1201992801 Y:20046844-20046866 TTCAAAAATCATTATGGGCTGGG + Intergenic