ID: 1140050946

View in Genome Browser
Species Human (GRCh38)
Location 16:71480498-71480520
Sequence CTGTCAGCAATGAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140050946_1140050949 22 Left 1140050946 16:71480498-71480520 CCATCATCACTCATTGCTGACAG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1140050949 16:71480543-71480565 TTTATTACCTACGTTATTTCTGG 0: 1
1: 0
2: 0
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140050946 Original CRISPR CTGTCAGCAATGAGTGATGA TGG (reversed) Intronic
902116234 1:14123930-14123952 TTGTCATCACTGAGAGATGAAGG - Intergenic
902125428 1:14206091-14206113 CTGTAAGTAATGAGTTATCAAGG + Intergenic
904055203 1:27665433-27665455 ATGTCAGTTATGATTGATGAAGG - Intergenic
904975775 1:34455202-34455224 CAGTCGGAAATGAGTGAAGACGG + Intergenic
905947133 1:41912776-41912798 CTGTCAGCAAATCTTGATGAGGG - Intronic
906026744 1:42680905-42680927 CTCTAAGCAATTGGTGATGATGG + Intergenic
906145276 1:43556952-43556974 CACTCAGCAATCAGTGATGCTGG - Intronic
910763541 1:90758578-90758600 CTGTGAGGAATGAGGGATGCAGG + Intergenic
912271936 1:108220202-108220224 CTGTCAGAAGTGAGGGATGGGGG + Intergenic
915076671 1:153313338-153313360 CTGTCAGGAATGCGTGAGGAGGG - Intergenic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918291779 1:183115560-183115582 CTGTAAGCCAGGAGTGATGGGGG + Exonic
921836649 1:219785244-219785266 ATGACAGCAAAGAGCGATGAAGG + Intronic
924551046 1:245077632-245077654 GTGTCTTCAATGAATGATGATGG + Intronic
1062793454 10:324198-324220 CTGTGAGAAATGTTTGATGATGG + Intronic
1062889301 10:1045903-1045925 GTGTCAGGAGTCAGTGATGATGG + Intronic
1063347708 10:5326832-5326854 TTGGCAGCAACCAGTGATGAAGG + Intergenic
1063758576 10:9044881-9044903 CTGTCAGCAGAGAGTGAACATGG + Intergenic
1066529363 10:36319730-36319752 GAGGCAGCAATGAGTTATGATGG - Intergenic
1070174216 10:73956597-73956619 ATGTCAGCATTTAGTGATGTGGG - Intergenic
1071120781 10:82275537-82275559 TTTTCAGCACAGAGTGATGATGG + Intronic
1071304837 10:84290044-84290066 CTGTCAGCCCTGAAGGATGAAGG + Intergenic
1071318276 10:84424843-84424865 ATGTAAGCACTGAGTGAAGATGG + Intronic
1071716991 10:88106955-88106977 CAGTCAGCAATGGGGGCTGAGGG - Intergenic
1071925669 10:90406297-90406319 TTGTCAGCAAAGAGTGTTGATGG + Intergenic
1073537021 10:104286706-104286728 CTGTCAGAATTGGATGATGAAGG - Intronic
1076187066 10:128458374-128458396 CTGTCAGGGATGAGAGATGCTGG + Intergenic
1076274524 10:129185521-129185543 CTGTCAGTAATGAGGTATTAGGG - Intergenic
1076465745 10:130680548-130680570 CTGTTTCCATTGAGTGATGAGGG + Intergenic
1076698019 10:132256475-132256497 CTGCCATAAATGAGTGATTAGGG + Intronic
1076714305 10:132355542-132355564 CTGCCAGCAGTGACTGATGCTGG - Intronic
1077776889 11:5281681-5281703 CTGACTGTGATGAGTGATGAAGG - Intronic
1078064048 11:8066346-8066368 GAGTCAGGAATGAGTGAGGATGG + Intronic
1078455333 11:11470445-11470467 CTGTCATCAGTGTGTGAGGAAGG + Intronic
1080896472 11:36452530-36452552 CTGGGAGGAATGAGTGAGGAAGG - Intronic
1080932490 11:36826327-36826349 TTGTCAGCAATGAGAGATGGAGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1081911381 11:46701881-46701903 GTGTCAGCAGTGAGTGAGGAAGG + Intronic
1083902319 11:65649631-65649653 CTGTCAGCACTGGGTACTGATGG - Exonic
1083934439 11:65863012-65863034 CTGCCAGGAATGAGTGAAGAAGG + Intronic
1087799564 11:102488944-102488966 ATGTCAGCATTGACTGATGTGGG - Intronic
1090934416 11:131329043-131329065 CAGTCAGCAATGAGTGAGGCAGG + Intergenic
1092091467 12:5807152-5807174 TTGTCAGCAATGAGTGGTCCAGG + Intronic
1093018137 12:14175531-14175553 TTGTCAGCAATTATTGATGCAGG + Intergenic
1094783336 12:33818252-33818274 CTGGCAGCAGTGGGTGGTGAGGG + Intergenic
1095242916 12:39882115-39882137 GGGGCAGGAATGAGTGATGATGG - Intronic
1095997394 12:48100002-48100024 CTATCAGCAATGAGAGAAAATGG + Intronic
1097724283 12:63056977-63056999 CTTTAAGCAATGACTGATGAAGG - Intergenic
1098267918 12:68741433-68741455 CTGACAGCAATGACTGTTGCTGG - Intronic
1099071604 12:78051165-78051187 CCGTCAGCATTGTGTGAAGAGGG + Intronic
1099158196 12:79206628-79206650 CTGAGAGCATTGAGTGATGTGGG - Intronic
1099502927 12:83435910-83435932 CTCACAGAAATGAGAGATGAAGG + Intergenic
1100583999 12:95962391-95962413 CTGGAAGAAGTGAGTGATGAAGG + Exonic
1101156975 12:101936875-101936897 CTGTGTGCCATGGGTGATGAGGG - Intronic
1101351801 12:103936594-103936616 CTGTCACCCAGGCGTGATGATGG - Intronic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1103269343 12:119659505-119659527 TTAACAGCAATGAGTGATCATGG - Intergenic
1103469680 12:121170014-121170036 ATGACAGAAATGAGTGATGTGGG - Intronic
1104211979 12:126697654-126697676 CTGTCAACAATGAGTGCTTTGGG + Intergenic
1108559795 13:51631324-51631346 CAGTCAGCAGTGAGCCATGATGG + Intronic
1118213963 14:63790620-63790642 TTCTTATCAATGAGTGATGAGGG + Intergenic
1119352093 14:73974319-73974341 CTCTCAGCAACCAGTGAGGAAGG - Intronic
1121959814 14:98248809-98248831 TTGTCATCAATTAGAGATGAGGG + Intergenic
1124904676 15:33857553-33857575 CTGGCAGAAAAGAGTAATGATGG - Intronic
1126582504 15:50254293-50254315 CTGTCAGCAAAGAGTCATCCTGG + Intronic
1127128423 15:55836422-55836444 CAGTCAGCTATGAGCTATGATGG - Intronic
1127610172 15:60629019-60629041 CTGCCAGCCATGAGAGAAGAGGG - Intronic
1128158606 15:65408377-65408399 CTGTCACCACTGTGTGATGATGG - Intronic
1128832781 15:70784996-70785018 CTGTCACCAATGAATGGTGGAGG - Intergenic
1128893453 15:71351677-71351699 CTGTCACCAGTGAGTGGAGATGG + Intronic
1129206198 15:74038318-74038340 CTATCAGCAAGGAGTCATTAGGG + Intronic
1130055957 15:80526288-80526310 CTGTCAGAAATCACTCATGATGG + Intronic
1131279779 15:91011403-91011425 CTGGCAGAAATGAGTGAGGGAGG - Intronic
1134411669 16:14007675-14007697 CCACCAGCAATGTGTGATGATGG + Intergenic
1134881891 16:17752204-17752226 ATGTCAAAAATGAATGATGATGG + Intergenic
1140050946 16:71480498-71480520 CTGTCAGCAATGAGTGATGATGG - Intronic
1141162304 16:81637729-81637751 GAGTGAGCAAAGAGTGATGAGGG + Intronic
1143095261 17:4475458-4475480 CGGACAGAAATCAGTGATGAGGG + Intronic
1143694377 17:8600698-8600720 CTGAAAGTAATGAGTGGTGATGG + Intronic
1144453216 17:15398345-15398367 GTGACAGGAATGAGAGATGAAGG - Intergenic
1149206494 17:54253866-54253888 ATATCAGCAATGAGTGTTCAGGG + Intergenic
1150001203 17:61441588-61441610 CTGGCAGCAAGGAGTTATGAGGG - Intergenic
1150479871 17:65500527-65500549 CATTCAGCAATGACTGAGGAGGG + Intergenic
1154205715 18:12335091-12335113 TTGTGAGCAATGAGTGAGGGAGG - Intronic
1155831378 18:30519004-30519026 CTGTCCTCAAGGGGTGATGAGGG + Intergenic
1157921571 18:51718486-51718508 CTGTCACCAATGAGTGTTAGAGG - Intergenic
1158365800 18:56734294-56734316 CTGTCACAAATGAGTTATCATGG - Intronic
1158502319 18:58013910-58013932 CTGTCAGCAAAGAGAGATTATGG + Intergenic
1159275576 18:66216766-66216788 CATTAAGCAATGAGTGGTGATGG + Intergenic
1160081434 18:75731155-75731177 CTGTCGGAAATGGGGGATGAAGG - Intergenic
1166040626 19:40200357-40200379 CTGTCACCAGTGAGAGTTGATGG + Intronic
926654123 2:15381027-15381049 CTGTCAGATATAAGTGATTAGGG - Intronic
927281067 2:21307123-21307145 ATGTCAACAAAGAGAGATGAAGG - Intergenic
928575178 2:32647332-32647354 CTGTCAGCAATAAGTGAGTCAGG - Intronic
929876568 2:45801487-45801509 CAGTCATCAGTGAGTGCTGAGGG + Intronic
936731488 2:115386407-115386429 CACTCAGTGATGAGTGATGATGG + Intronic
938443705 2:131359566-131359588 TTATCAGCAAAGAGTGAAGATGG - Intergenic
940068253 2:149653987-149654009 CTGACAGCAGTGAGTGAGGTGGG - Intergenic
942626821 2:177910114-177910136 CAGTGTGCAATGAGTCATGAAGG - Intronic
1170309659 20:14978519-14978541 CTGTGACCAATGACTGATAATGG - Intronic
1173382982 20:42562736-42562758 TTGTCAGGGCTGAGTGATGAGGG - Intronic
1174547705 20:51338045-51338067 CTCTCAGCCATTAGAGATGAGGG - Intergenic
1174974315 20:55314508-55314530 TTGACAGCAATGAGTTAAGAAGG - Intergenic
1178187721 21:30242976-30242998 CTGTCTGGATTGAGTGCTGATGG + Intergenic
1178231163 21:30785902-30785924 CTTTCAACATTGAGTGGTGATGG + Intergenic
1181638926 22:24186875-24186897 CTGTCAGCACTGAGGGTTCAGGG + Intronic
1183878163 22:40802185-40802207 CTGGCAGAAAAGAGGGATGAAGG - Intronic
1184784342 22:46664524-46664546 CTGTGAGCCATGAGTCCTGAGGG + Intronic
949090510 3:22561-22583 CTGTCAGGAACTATTGATGATGG + Intergenic
951605046 3:24423551-24423573 ATGTCAAGAATGAGTGTTGAAGG - Intronic
953156551 3:40380408-40380430 CTAACAGCAATGTGTGATTATGG - Intergenic
953401851 3:42629900-42629922 CTGACAGCAAAAAGTAATGATGG - Intronic
953517912 3:43614617-43614639 CTGTCAGCAATGCGTGAAAATGG - Intronic
954052673 3:47994423-47994445 CTTTCACCTATGACTGATGAGGG - Intronic
955398169 3:58572379-58572401 CTGTCAGCCAGGTGTGGTGAGGG + Intronic
956367266 3:68518100-68518122 ATGTCTGCAATGAGTGCTAAAGG - Intronic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
957542323 3:81588397-81588419 CTGTCAAGAATGACTGGTGATGG + Intronic
957722794 3:84025855-84025877 CTGTGAGGAAAGAGTGATGTGGG - Intergenic
962036736 3:131659803-131659825 CTCTCAGCAATCTGGGATGAGGG - Intronic
963215418 3:142740853-142740875 AAGTTAGCAAAGAGTGATGAAGG + Intronic
964781201 3:160340249-160340271 GTGTTAGCAATGAGTCATGTAGG - Intronic
966674477 3:182570608-182570630 ATGTCAGCGATGACTGGTGATGG - Intergenic
967292551 3:187935655-187935677 CTAGCAGCAATGAGTGCTGACGG + Intergenic
975576617 4:75869341-75869363 CTTTCTTCAATGAGTGTTGAGGG - Intronic
976050268 4:81003826-81003848 CTGAAAGCAATGGGTGATGGAGG + Intergenic
976673932 4:87683853-87683875 ATGTGAGCATTGAGTGATCAGGG - Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981989327 4:150897738-150897760 CATTAAGCAATTAGTGATGAAGG - Exonic
983194858 4:164795956-164795978 ATGTCAGCAAGGAGTGAAGGTGG - Intergenic
986181685 5:5398994-5399016 CTGTCAGCAAATAGTCATGGAGG + Intergenic
987379097 5:17267379-17267401 CTGTAAGGAATGAGTCAGGATGG - Intronic
988713056 5:33797565-33797587 ATGTCAGAACTTAGTGATGAAGG + Intronic
989717559 5:44482161-44482183 CTGTAAGCACACAGTGATGAGGG + Intergenic
991954722 5:71983171-71983193 CAGCCAGCAATTAGTGCTGAGGG + Intergenic
992233094 5:74682838-74682860 GTGTCAGCCATGACTCATGATGG - Intronic
993308606 5:86299803-86299825 CTGTCAGAAGTGAGGGATGGGGG - Intergenic
994837738 5:104877472-104877494 CTGTCAGAAGTGAGTGATTGAGG - Intergenic
995457466 5:112367424-112367446 GTGTAAGCAGTGAGTGATAAGGG - Intronic
999188006 5:149727215-149727237 CTGTGAGCAACCTGTGATGAAGG + Intergenic
1003052068 6:2789025-2789047 CTGGCAGGAGTGAGTCATGACGG - Intergenic
1007932264 6:45702314-45702336 CTGTCCGCCTTGAGTGATCAGGG + Intergenic
1008018700 6:46551087-46551109 CTGTCAACCATGAGGGCTGAGGG + Intronic
1008068349 6:47074259-47074281 CTGTCAGCCAGAAGAGATGAAGG + Intergenic
1011982552 6:93400593-93400615 CAGTGAGCAGTGAGTGATAATGG - Intronic
1014311870 6:119813786-119813808 CTGTCAGCAATTCTTGTTGATGG + Intergenic
1016164182 6:140919371-140919393 TTGTCACCATTGAGTGATAAAGG + Intergenic
1020506057 7:8989567-8989589 CTGTTAGAAAAGAGTGGTGAGGG - Intergenic
1023249756 7:38245660-38245682 ATGTCAGCAGTGTGTGCTGAAGG - Intergenic
1023251139 7:38262592-38262614 ATGTCAGCAGTGTGTGTTGAAGG - Intergenic
1027699215 7:81449073-81449095 CTCTCAGGAATGTGTTATGATGG + Intergenic
1030804807 7:113902937-113902959 CTGGAAGAAATGAATGATGAAGG - Intronic
1030968594 7:116025331-116025353 CTTTCAGAAATGTGGGATGAAGG + Intronic
1031936600 7:127741618-127741640 ATGTTAGCAAAGAGTGAGGAAGG - Intronic
1033573713 7:142659176-142659198 TTCTAGGCAATGAGTGATGAGGG - Intergenic
1034502945 7:151462791-151462813 CTGCCAGCAATGGGTTATCATGG - Intergenic
1034819648 7:154205055-154205077 ATATCAGCAATGACTAATGAAGG - Intronic
1037643242 8:20767899-20767921 CTGTCATGAATAAGGGATGAGGG + Intergenic
1042435099 8:68755229-68755251 CTGTCAAGATTCAGTGATGAGGG + Intronic
1043106325 8:76116356-76116378 CTCTTAGTAATGAGTGATGACGG - Intergenic
1043471441 8:80566798-80566820 ATATCACCAATGAATGATGATGG + Intergenic
1043637742 8:82407652-82407674 CTGTCTGCTATGAGTCATAATGG + Intergenic
1044100565 8:88131844-88131866 CTTTCAACAATGAGAGAAGAGGG - Intronic
1045113526 8:98956034-98956056 CTGACAGCAATGAGCAATAAAGG + Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1046986098 8:120390611-120390633 GTGTCAGCAATGGTGGATGAGGG + Intronic
1048256752 8:132910659-132910681 ATGTCAGCCATGTGTGGTGAAGG - Intronic
1048793685 8:138128932-138128954 ATTTCAGAAATGAGTGATGGTGG + Intergenic
1048950422 8:139492127-139492149 CTGTGAGCACTGAGTGCTAATGG - Intergenic
1050668192 9:7965650-7965672 TCGTCAGCAATGAGGAATGATGG + Intergenic
1050812922 9:9772761-9772783 CCACCAGCAATGAGTGAAGATGG - Intronic
1051908836 9:22129227-22129249 CTTACAGCAATGAGTGTTGCTGG + Intergenic
1056048344 9:82742253-82742275 GTCTCAGCAATGAGAAATGACGG - Intergenic
1058748167 9:108012402-108012424 CTATCAGAAATGACTGATGCAGG - Intergenic
1059549457 9:115214258-115214280 CTGTGAGCAAGGGGTGATGGGGG + Intronic
1060803433 9:126558914-126558936 CTGGCAGCAATGAGGACTGAGGG + Intergenic
1186325577 X:8473152-8473174 CTGTCATCTATGTGTGATGTTGG - Intergenic
1189807581 X:44751109-44751131 GTGTTAGCAATGAGTATTGAGGG - Intergenic
1196616750 X:117775219-117775241 CTGTCAGCAAAGAGTAATGTAGG - Intergenic
1199185037 X:144906853-144906875 CTTTCAGCAATTAGCGATCATGG + Intergenic
1201265343 Y:12201078-12201100 CTGCCAGATGTGAGTGATGATGG + Intergenic