ID: 1140051341

View in Genome Browser
Species Human (GRCh38)
Location 16:71484251-71484273
Sequence CCAGTTCCTGCTCTAGATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140051341_1140051346 23 Left 1140051341 16:71484251-71484273 CCGGAATCTAGAGCAGGAACTGG 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1140051346 16:71484297-71484319 TGTGGCCCAATGAGCAGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 151
1140051341_1140051350 29 Left 1140051341 16:71484251-71484273 CCGGAATCTAGAGCAGGAACTGG 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1140051350 16:71484303-71484325 CCAATGAGCAGATGGGGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 195
1140051341_1140051344 21 Left 1140051341 16:71484251-71484273 CCGGAATCTAGAGCAGGAACTGG 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1140051344 16:71484295-71484317 GCTGTGGCCCAATGAGCAGATGG 0: 1
1: 0
2: 0
3: 18
4: 185
1140051341_1140051348 28 Left 1140051341 16:71484251-71484273 CCGGAATCTAGAGCAGGAACTGG 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1140051348 16:71484302-71484324 CCCAATGAGCAGATGGGGTTTGG 0: 1
1: 0
2: 1
3: 11
4: 171
1140051341_1140051343 5 Left 1140051341 16:71484251-71484273 CCGGAATCTAGAGCAGGAACTGG 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1140051343 16:71484279-71484301 AGCTGCTCAGTAAGCAGCTGTGG 0: 1
1: 0
2: 4
3: 51
4: 503
1140051341_1140051345 22 Left 1140051341 16:71484251-71484273 CCGGAATCTAGAGCAGGAACTGG 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1140051345 16:71484296-71484318 CTGTGGCCCAATGAGCAGATGGG 0: 1
1: 0
2: 1
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140051341 Original CRISPR CCAGTTCCTGCTCTAGATTC CGG (reversed) Intronic
900342606 1:2195847-2195869 CACCTTCCTGCTCTAGATGCTGG + Intronic
900516046 1:3082667-3082689 CCAGGTCCAGCTCCAGATCCTGG - Intronic
901180480 1:7338132-7338154 CCACTTCCTCCTCCAGATTTTGG + Intronic
901771744 1:11534058-11534080 CCAGTTCCTGCTCATCCTTCAGG - Intronic
902523267 1:17034905-17034927 CCAGGTTCTGTTCTAGATGCTGG + Intronic
902576801 1:17383212-17383234 CCACTTCCTGGTCTACACTCTGG + Intronic
902843317 1:19089363-19089385 CCAGTGCCTGCTCTGGCTGCTGG - Intronic
902941103 1:19800545-19800567 CCATTTCCTGCTTTCCATTCTGG + Intergenic
904131749 1:28280798-28280820 CCAGGTCCTGCTCAGGAGTCAGG - Exonic
907075119 1:51571200-51571222 TCAGGTCCTGTTCCAGATTCAGG - Intergenic
907081675 1:51629337-51629359 CCAGGCACTGCTCTAGATGCTGG - Intronic
907594883 1:55710682-55710704 CCATTTCCTTGTCTAGATTTGGG + Intergenic
908119978 1:60976876-60976898 CCAGTGTCTCCTCTAGATTGTGG - Intronic
908365362 1:63417689-63417711 CCAGGTCCTCCTCTAGGTACTGG + Intronic
910852171 1:91659207-91659229 CCAGGTACTGTTCTAGATGCTGG - Intergenic
911885977 1:103300099-103300121 CATTTTCCTGCTCTTGATTCTGG - Intergenic
912258096 1:108081725-108081747 CCAGGTACTGTTCTAGACTCTGG + Intergenic
912869510 1:113291231-113291253 CCAGGCCCTGCTCTAGGTGCTGG - Intergenic
913587088 1:120286436-120286458 CCAGCTACTGTGCTAGATTCTGG + Intergenic
913621097 1:120611934-120611956 CCAGCTACTGTGCTAGATTCTGG - Intergenic
914569103 1:148898321-148898343 CCAGCTACTGTGCTAGATTCTGG + Intronic
914603724 1:149231935-149231957 CCAGCTACTGTGCTAGATTCTGG - Intergenic
916060604 1:161096089-161096111 CCAGTCCCTGCTCTCATTTCTGG + Intergenic
917300605 1:173570345-173570367 CCAGTTCAGGCTCTAGTTCCTGG - Intronic
917695318 1:177517050-177517072 CCAGTTTCTGCCCATGATTCTGG - Intergenic
917979012 1:180258053-180258075 CCAGGTCCTGCTCTGGGTGCTGG + Intronic
919752254 1:201044928-201044950 CCAGGTCCTGCTCTGGCCTCTGG + Intronic
920712718 1:208310383-208310405 CCAGTTCCTGAGCCAAATTCAGG + Intergenic
921167578 1:212517958-212517980 CCAGTCACTGCTCTAGACACTGG - Intergenic
923484295 1:234414274-234414296 CCAACTCCTGATCTAGAGTCAGG + Intronic
924197682 1:241625042-241625064 CCAGTTTCTGTGCTAGACTCTGG - Intronic
924204935 1:241702610-241702632 CTAATCCCTGCTCTAGATGCAGG - Intronic
924886428 1:248222234-248222256 GCAGATCCTGCTCTAGCTTCAGG - Intergenic
1064539645 10:16392367-16392389 CCAGATGCTGCTCTAGACACTGG + Intergenic
1064695632 10:17962654-17962676 TTAGTTCCTGCTCTCAATTCTGG + Intronic
1070518049 10:77226022-77226044 CCCCTTCCTCCCCTAGATTCTGG - Intronic
1073101081 10:101007042-101007064 GCAGCTCCTGCTCTAGCTGCCGG - Exonic
1073340296 10:102739216-102739238 CCAGATCCTGCTTTCCATTCAGG - Exonic
1073527598 10:104199457-104199479 CCAGTCACTGCTTTAGATGCTGG + Intronic
1073710895 10:106039241-106039263 CCAGTACCTGCTCTAGTAGCAGG + Intergenic
1073865179 10:107794808-107794830 CCTTTTCCTCCTCTATATTCTGG + Intergenic
1074673355 10:115820884-115820906 CCAGGTCCTGCCCTAGACACTGG - Intronic
1075282745 10:121154446-121154468 CCAGTCCCTGCACTAGATTCTGG - Intergenic
1076085569 10:127627220-127627242 CCAGCTACAGTTCTAGATTCTGG - Intergenic
1076814145 10:132906388-132906410 CCATTTCCTGCTCTAGAGCCTGG + Intronic
1078601664 11:12737591-12737613 TCAGTTGCAGCTCTATATTCTGG + Intronic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1080562495 11:33476705-33476727 CCAGCTCCTGCTCATCATTCAGG + Intergenic
1081703990 11:45169909-45169931 CCAGGCACTGCTCTAGTTTCAGG + Intronic
1084605832 11:70171111-70171133 CCAGCTCTGGCTCTAGCTTCTGG - Intronic
1085272027 11:75275741-75275763 CCACTTCCTCCTCTACATACTGG + Intronic
1088071706 11:105794373-105794395 CCAGTTCCTGTTCTATTTGCTGG - Intronic
1090035851 11:123248916-123248938 TCAGGTGCTGTTCTAGATTCTGG + Intergenic
1091241963 11:134059013-134059035 TCAGTTTCTGCCCTAGGTTCTGG - Intergenic
1091801630 12:3328202-3328224 CCAGCTCCTGCTCTACCTGCAGG + Intergenic
1095882216 12:47150201-47150223 CCAGGTACTGCTCTAGATCAGGG + Intronic
1096654024 12:53077329-53077351 CCAGTGCCTTCTCTACCTTCTGG - Intronic
1098169902 12:67736764-67736786 CCAGTCTCTCCCCTAGATTCTGG - Intergenic
1101108531 12:101462989-101463011 ATAGTTGCTGCTCTAGATGCTGG - Intergenic
1102420792 12:112801279-112801301 CCAGCTCCTGCTCCAAATGCTGG - Intronic
1102707767 12:114896745-114896767 CAAGTTCCTGTTCTTAATTCTGG + Intergenic
1103042240 12:117705237-117705259 CCAGTTCCTGCTCTCTAGTATGG - Intronic
1104528880 12:129550152-129550174 CCAGTGCTTGCTGTAGAATCTGG - Intronic
1104556000 12:129800421-129800443 CCAGGCCCTGGGCTAGATTCAGG + Intronic
1104719073 12:131034630-131034652 CCAGGTTCTGTTCTAGACTCAGG - Intronic
1104933812 12:132354072-132354094 CCACTTCCTGATCAAAATTCGGG - Intergenic
1108960133 13:56216758-56216780 CCACTTCCTGCTGTGGCTTCTGG + Intergenic
1111669135 13:91306002-91306024 CCAATTCCTGTCCTAGAATCTGG + Intergenic
1115705180 14:35990929-35990951 CCATTTCCTGCACTAGTTTGAGG + Intergenic
1117524207 14:56580632-56580654 CTAGTTCCTTCTCAATATTCAGG - Intronic
1117543186 14:56768716-56768738 CCAGTTCCTTCTGTAGATACAGG - Intergenic
1119221012 14:72907387-72907409 CCAGGTCCTGCTCTAGTGGCTGG - Intergenic
1119674118 14:76540971-76540993 CCAGTTCCAGCCCTACCTTCAGG - Intergenic
1121817196 14:96937905-96937927 CCAGTTCCTGAACAAGATTCAGG - Intergenic
1122462879 14:101910486-101910508 CCAGGCCCTGTTTTAGATTCTGG + Intronic
1122695166 14:103548860-103548882 CCAGGTGCTGCTCTAGGTACTGG + Intergenic
1123059636 14:105588692-105588714 CCAGTTCCTGCTCTGGGTGGGGG + Intergenic
1123693289 15:22857499-22857521 CCAGGTCCTGTTCTAGAATCAGG - Intronic
1126552119 15:49943329-49943351 CCATTTCCTTCTCTAGAGTTGGG - Intronic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1128358228 15:66943292-66943314 CCAGAGCCTGCTCTAGAGACAGG + Intergenic
1128607030 15:69044280-69044302 CCAGGTTCTGTTCTAGATGCTGG + Intronic
1129686108 15:77686927-77686949 CCAGGCCCTGCACTAGTTTCTGG - Intronic
1129726577 15:77904565-77904587 CCAGCTCCTGCTCTACAATGTGG + Intergenic
1130639436 15:85657307-85657329 CCAGACTCTGCTCTAGGTTCTGG + Intronic
1130948292 15:88565990-88566012 CCAGTGCCTGCTGCAGAGTCAGG - Intergenic
1131218353 15:90559142-90559164 CCAGGTACTGCTCTAGACTTTGG - Intronic
1132303117 15:100788641-100788663 CCAGTTCATGCTCCAGATGCAGG - Intergenic
1133749680 16:8714746-8714768 CCAGTGCCTACTCCAGAGTCAGG - Intronic
1135985346 16:27179745-27179767 CCAGTTCCTGCTTTAGTGTCAGG - Intergenic
1136483084 16:30555084-30555106 CCAGCTCTTGCCCTAGATTCTGG + Exonic
1137758016 16:50918079-50918101 CTAGTTCCTGCTCGAGATGGAGG - Intergenic
1137801668 16:51267137-51267159 CCAGCCCCTGCTCCAGCTTCAGG - Intergenic
1139293396 16:65878245-65878267 CCAGGTCCTGCTCCAGGTGCTGG - Intergenic
1140051341 16:71484251-71484273 CCAGTTCCTGCTCTAGATTCCGG - Intronic
1141926138 16:87170890-87170912 CCAGGCCCTGCTCTAGGCTCTGG - Intronic
1143025072 17:3936664-3936686 CCAGTCCCAGCTCTGGATCCTGG + Intronic
1143863839 17:9909856-9909878 CCAGACACTGCTCTAGGTTCTGG - Intergenic
1144103434 17:11964167-11964189 CAACTTCCTTCTCAAGATTCAGG - Intronic
1146087270 17:29841169-29841191 CCATTTCCTGATCTAGGTACAGG + Intronic
1147461673 17:40576144-40576166 CCAGCTCCTGCCCCAGTTTCTGG + Intergenic
1150586532 17:66523275-66523297 CCAGTTCCTCCCCGAAATTCAGG + Intronic
1153074495 18:1147517-1147539 CCAGGTCCTGGCCTGGATTCTGG - Intergenic
1153162385 18:2222190-2222212 CCAGGTGCTGCTCTAGGATCTGG - Intergenic
1153471890 18:5455831-5455853 ACATTTCCTGCTGTGGATTCAGG + Intronic
1156009155 18:32476047-32476069 GCAGTTCCTGTTCTAGACTGTGG - Intergenic
1156161898 18:34369659-34369681 CCATTTCCTTTTCTAGTTTCTGG - Intergenic
1158152981 18:54393316-54393338 GAAGTCCCTGCTCTAGTTTCTGG + Intergenic
1158346689 18:56523424-56523446 CCAGTTCCTCCTCTAAACTTAGG + Intergenic
1158432809 18:57405266-57405288 CCAGTTCCTGGTCTTGGCTCAGG - Intergenic
1158625275 18:59066005-59066027 CCAGGTACTGTTCTAGAATCTGG + Intergenic
1159995757 18:74962442-74962464 CCAGATCCTGCTCTAGCCCCTGG - Intronic
1162853557 19:13450601-13450623 CCAGGTCCTGTTCTAGGCTCTGG - Intronic
1163497767 19:17656505-17656527 CCAGGTCCTGCTCTAGGGGCTGG + Intronic
1163781488 19:19251626-19251648 CCAAATCCTGCTCTGGACTCTGG + Exonic
1165716210 19:38047427-38047449 CCAGGTCCTGTTCTAGATGCTGG - Intronic
1165899093 19:39160330-39160352 CCAGCCACTGCTCTAGATGCCGG + Intronic
1166619650 19:44284717-44284739 CAAGTTCCTGCTATAGATCTGGG + Intronic
1167142026 19:47658320-47658342 CCAGTTCCTGGTCAAGGTCCAGG - Intronic
925342341 2:3146260-3146282 CCAGGTCCTGCTTTGGAATCAGG - Intergenic
927251862 2:21002956-21002978 ACAGTTCCTGGTACAGATTCTGG + Exonic
929199378 2:39219098-39219120 CCAGGTCCTGTTCTAGGTGCTGG - Intronic
929551204 2:42893363-42893385 CCAGCCCCTGAGCTAGATTCTGG - Intergenic
932045251 2:68341989-68342011 CCAGGTCCTGTTCTAGATGCTGG + Intergenic
934768874 2:96895519-96895541 CCAGTGCATGCACTTGATTCGGG + Intronic
935685638 2:105680308-105680330 CCAGGTACTGCTCTAGAGGCTGG + Intergenic
938785410 2:134624130-134624152 CCAGCCCCTGCTCTATAATCTGG + Intronic
941015741 2:160354095-160354117 TCAGGTCCTTCTATAGATTCAGG - Intronic
941132273 2:161667309-161667331 CCAGATTCTGCTCTAGGTGCTGG + Intronic
941801132 2:169661043-169661065 CCTGTTCTTGCACTAGATGCTGG + Intronic
943685703 2:190815763-190815785 TCAGTTCCTGGCCCAGATTCTGG + Intergenic
945478802 2:210320419-210320441 ACAGTTCCTCCTCTAGATTTGGG + Intergenic
945626561 2:212214610-212214632 CCAGTTCTTGCTCTATGTTCTGG - Intronic
946194992 2:218027565-218027587 TCAGTCCCTGCTCTAGAAACAGG + Intergenic
946425278 2:219591701-219591723 CCAGATCCTGTGTTAGATTCTGG - Intergenic
947542303 2:230987456-230987478 CCTGATCCTGCTCCTGATTCTGG - Intergenic
947684828 2:232073827-232073849 CCAGTTTCTTCTCTAGATCCTGG + Intronic
947875067 2:233462372-233462394 CCAGTTCCTGCTCCATGTCCCGG - Exonic
1168897940 20:1336802-1336824 CCAGTTCCGCCTCTAGTGTCTGG - Intronic
1171380888 20:24733149-24733171 CCAGTTGCTGTTCTAGAAGCTGG + Intergenic
1171520075 20:25769066-25769088 CCAGGTACTGCTCTAGATGCTGG - Intronic
1171556844 20:26087427-26087449 CCAGGTACTGCTCTAGATGCTGG + Intergenic
1174005163 20:47404818-47404840 CCAGGTCCTGTTCTAGGTGCTGG + Intergenic
1174419602 20:50391036-50391058 CCAGTTCCAGCTCTGCCTTCAGG - Intergenic
1174435652 20:50504991-50505013 CCCTTTCCTGTTCTAGCTTCTGG - Intergenic
1176004879 20:62855867-62855889 CCAGTTTCTGCTTTAAGTTCAGG - Intronic
1176104499 20:63379553-63379575 CCAGTGCCTGCTCTGATTTCAGG + Intergenic
1176654207 21:9575342-9575364 CCAGGTACTGCTCTAGATGTTGG - Intergenic
1183012788 22:34961031-34961053 CCAGTTACTGTTCTAGGTGCTGG + Intergenic
1184046939 22:41977593-41977615 CCAGTTCCAGCCCTAGGCTCTGG - Intronic
1184240858 22:43210624-43210646 CCAGGCCCTGCTCTAGTTTCTGG - Intronic
950213676 3:11142402-11142424 CCAGTTACTGCTCTAAGTGCTGG + Intronic
954420753 3:50417861-50417883 CCAGATCCTGCACTAGTTGCTGG - Intronic
954677563 3:52324250-52324272 CCAGGTCCTGTTCTAGGTGCTGG - Intronic
955503782 3:59611016-59611038 CCAGGTCCTGCTCTAAACTATGG + Intergenic
961430079 3:126875204-126875226 CCTCTTCCTGCTCTGGATTCTGG - Intronic
961818850 3:129565032-129565054 CCCTTCCCTGCTCTGGATTCAGG - Intronic
963957013 3:151265137-151265159 CCAGATACTGCTCTAGGTGCTGG - Intronic
964120627 3:153179451-153179473 CCAGCTTCTGTTCTAGATACTGG - Intergenic
968500514 4:947751-947773 CCAGTGCCTGCTCTGGGGTCCGG - Exonic
970205510 4:13651725-13651747 CCAGGTACTGCTGTGGATTCTGG - Intergenic
972411431 4:38799433-38799455 CCAGAGCCTCCTCTAGCTTCTGG - Intronic
975863956 4:78706800-78706822 CCAGGTACTGCTCTAGGTTTGGG - Intergenic
976215932 4:82715459-82715481 CCAGTTCCTAATCTAGGCTCTGG - Intronic
978535559 4:109758302-109758324 CCAGTCCCTGCTCTAGGTGGTGG - Intronic
978818726 4:112938898-112938920 GCAGGTACTGTTCTAGATTCTGG - Intronic
980879046 4:138690847-138690869 CCAGGCCCTGTGCTAGATTCGGG - Intergenic
982081648 4:151796345-151796367 GCAGGTCCTGTTCTAGATGCTGG + Intergenic
982873389 4:160613032-160613054 CCAGTCACTGCTCTAGTTGCTGG + Intergenic
983051282 4:163050485-163050507 TGAGTCACTGCTCTAGATTCTGG - Intergenic
983873949 4:172854221-172854243 CCATATCCTACTCTAAATTCTGG + Intronic
984367299 4:178815853-178815875 CCAGTCCCTGTTCTAGAATAAGG + Intergenic
985081746 4:186272618-186272640 CCAATCCCTGCTCTAGGTTCTGG - Intronic
985860699 5:2468426-2468448 CCATTTTCTTCACTAGATTCAGG - Intergenic
985946915 5:3192898-3192920 TCAGTTCCTGCTCTGGCTTTGGG - Intergenic
986613848 5:9596914-9596936 CCAGGTCCTGCTCTAGGTGCTGG - Intergenic
986644748 5:9905933-9905955 CCAGATTCTTGTCTAGATTCAGG + Intergenic
994128831 5:96200500-96200522 CCAGGTACTGTTCTAGGTTCTGG - Intergenic
994551520 5:101240136-101240158 CCAGTTCCTGTGCTTGTTTCTGG + Intergenic
997151973 5:131506707-131506729 CCAGGTACTGTTCTAGATACGGG - Intronic
997284013 5:132665487-132665509 CCAGACCCTGCTCTAGGTGCTGG + Intergenic
997331879 5:133069588-133069610 CCAGGTCCTGTTCTAGGTGCTGG + Intronic
997887219 5:137640740-137640762 CCAACTCCTGCTCTAGAGACAGG + Intronic
998375917 5:141690633-141690655 ACAGTGCATGCTCCAGATTCAGG - Intergenic
998413853 5:141930947-141930969 CCAGTTCCTGTTTTAGGTACTGG + Intronic
999694645 5:154178398-154178420 CCAGTTCCAGTTCTGGTTTCTGG - Intronic
999949133 5:156629818-156629840 CCAGTCCCTGGTCTAGGCTCTGG + Intronic
1002505861 5:179678756-179678778 GCAGTTCCTGCTGCAGCTTCAGG + Exonic
1004335014 6:14756585-14756607 CCAGGCTCTGCTCTAGATCCTGG + Intergenic
1005376509 6:25187813-25187835 CCAGGTACTGCTCTAGGTTTTGG + Intergenic
1005412661 6:25566673-25566695 CCAGGCACTGCTCTAGATACTGG - Intronic
1006460139 6:34153330-34153352 TCAGTCCCTGCCCCAGATTCTGG + Intronic
1007320140 6:41022261-41022283 CCAGCTCCTCCTTTAGATTAGGG + Intergenic
1008501735 6:52190381-52190403 CCAGTTTCTCCCCTAGACTCAGG + Exonic
1012956074 6:105571556-105571578 CCAGATCCTGAGCTAGATCCAGG - Intergenic
1016563835 6:145429396-145429418 CCAGGTCTTGTTCTAGATGCAGG - Intergenic
1018612826 6:165661362-165661384 CCAGTCCATGCTCTGGATGCCGG + Intronic
1019587033 7:1810700-1810722 CCAGTTCTTTCTCGAGGTTCTGG + Intergenic
1020473180 7:8563181-8563203 CCAGTTCCTGTTCTAAACTTTGG + Intronic
1021438340 7:20648007-20648029 ACAGTTCCTTCTATGGATTCAGG - Exonic
1024564353 7:50669326-50669348 CCAGTTCCTGCTTTGCCTTCTGG - Intronic
1025280559 7:57624010-57624032 CCAGGTACTGCTCTAGATGCTGG - Intergenic
1025304171 7:57841497-57841519 CCAGGTACTGCTCTAGATGCTGG + Intergenic
1030313584 7:108092017-108092039 CCAGGTTCTGCTCTAAAATCTGG + Intronic
1031484886 7:122313985-122314007 ACAGTTTCTTCTGTAGATTCAGG + Intergenic
1033328980 7:140402554-140402576 GCAGTTACTGTTCTAGACTCTGG + Intronic
1037584697 8:20268498-20268520 CCATTTGCTGCTCTAGATGAGGG + Intronic
1037607917 8:20452956-20452978 CCACTTCCTCCTCCAGAATCAGG - Intergenic
1037812801 8:22096846-22096868 CCAGGCTCTGCTCTAGATGCTGG + Intronic
1043164385 8:76885155-76885177 CCAGTCACTGCTCTAAATTCTGG + Intergenic
1043329019 8:79090250-79090272 CCAGTTCCTACTCAAGAATAGGG - Intergenic
1044321582 8:90808208-90808230 TCAGGTCCTGCTCCAGATCCTGG + Intronic
1044571769 8:93726961-93726983 TCAGCCCCTGCTCTAGATACTGG - Intronic
1045438019 8:102184103-102184125 CCAATTCCTTCTCAAGATTTTGG - Intergenic
1047111497 8:121794179-121794201 CCAGTCACTGCTCTAGATATGGG - Intergenic
1047911005 8:129529032-129529054 TCAAATCCTGCTCTAGATTAGGG - Intergenic
1051195911 9:14562812-14562834 CTAGTTCCTACTCTAGCTTAGGG + Intergenic
1055317131 9:75045241-75045263 CCAGATCCTGGACTGGATTCTGG - Intergenic
1055323272 9:75102678-75102700 CCAGACCCTGCTCTTTATTCTGG + Intronic
1058168717 9:101652312-101652334 CCAGTCTCTGTACTAGATTCTGG + Intronic
1060934663 9:127508110-127508132 CCCGTTCCTGCTCAAGAAGCTGG - Exonic
1061760389 9:132847174-132847196 GCAGTTCCTGCTCAAGTTCCTGG + Intronic
1203631928 Un_KI270750v1:78800-78822 CCAGGTACTGCTCTAGATGTTGG - Intergenic
1185465299 X:350936-350958 CCAGTCCCTGCTCTGGCGTCCGG - Intronic
1185856576 X:3541906-3541928 CCAATTCCTGCTCTAAATGATGG + Intergenic
1187982699 X:24775460-24775482 CATGTGCGTGCTCTAGATTCTGG - Intronic
1190290600 X:48989625-48989647 CAAGTTCCTGCTGCAGCTTCTGG + Exonic
1193786238 X:85762746-85762768 TCAGTTTCTACTTTAGATTCAGG + Intergenic
1197145540 X:123168135-123168157 CCAGATACTGTTCTAGATACTGG - Intergenic
1198449803 X:136755526-136755548 CCAGTCTCTGCTGTAAATTCTGG - Intronic
1199194325 X:145009145-145009167 CCACTCCTTGCCCTAGATTCTGG - Intergenic
1200807592 Y:7448216-7448238 CCAATTCCTGCTCTAAATGATGG - Intergenic
1201782642 Y:17740442-17740464 CCAGCTCCTTCTCTATATGCTGG - Intergenic
1201818911 Y:18165546-18165568 CCAGCTCCTTCTCTATATGCTGG + Intergenic