ID: 1140051377

View in Genome Browser
Species Human (GRCh38)
Location 16:71484420-71484442
Sequence CACCAGAGGGAGACCGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140051365_1140051377 12 Left 1140051365 16:71484385-71484407 CCCAAGGCGCCGATGCAGGCGTG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG 0: 1
1: 0
2: 1
3: 14
4: 294
1140051371_1140051377 3 Left 1140051371 16:71484394-71484416 CCGATGCAGGCGTGGGGGAGCGA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG 0: 1
1: 0
2: 1
3: 14
4: 294
1140051366_1140051377 11 Left 1140051366 16:71484386-71484408 CCAAGGCGCCGATGCAGGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG 0: 1
1: 0
2: 1
3: 14
4: 294
1140051363_1140051377 18 Left 1140051363 16:71484379-71484401 CCATTTCCCAAGGCGCCGATGCA 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG 0: 1
1: 0
2: 1
3: 14
4: 294
1140051361_1140051377 27 Left 1140051361 16:71484370-71484392 CCACAGCCTCCATTTCCCAAGGC 0: 1
1: 0
2: 3
3: 65
4: 579
Right 1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG 0: 1
1: 0
2: 1
3: 14
4: 294
1140051362_1140051377 21 Left 1140051362 16:71484376-71484398 CCTCCATTTCCCAAGGCGCCGAT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG 0: 1
1: 0
2: 1
3: 14
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140051377 Original CRISPR CACCAGAGGGAGACCGGGAC CGG Intronic
900396082 1:2453802-2453824 CCCCACCGGGAGACGGGGACAGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901724598 1:11230961-11230983 CAGCAGAGGCATCCCGGGACTGG + Exonic
902770073 1:18640795-18640817 GACCAGAGGGAGAGAGGGAGGGG + Intronic
902880594 1:19369658-19369680 CTCCAGAGGGATCCCGTGACGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904697720 1:32339545-32339567 CCCCAGAAGGAGATGGGGACTGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904840251 1:33367932-33367954 CAGCAGAGGGCGCCAGGGACCGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907223895 1:52927369-52927391 CACCAGTGCGGGACCGGGGCGGG - Exonic
907362399 1:53929161-53929183 CACCAGGGGGAGACTGGGGTGGG + Intronic
907556989 1:55352637-55352659 CGCCAGAAGGAGACCAGGCCAGG - Intergenic
908016378 1:59841858-59841880 AAACAGAGGGAGACAGAGACAGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909101722 1:71357383-71357405 CACCAGAGGGAGACCCAGTTAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910777688 1:90892511-90892533 CATCAGAGGGAGACGTGGAGAGG + Intergenic
911569616 1:99507593-99507615 CAACAGAGGGAGAGGGGGAGGGG - Intergenic
912570807 1:110619606-110619628 CAGCAGGGAGAGACCGGGAGTGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
916125723 1:161569208-161569230 CATCAGAGGGACACCAGGAGGGG + Intergenic
916135639 1:161651039-161651061 CATCAGAGGGACACCAGGAGGGG + Intronic
922427137 1:225509255-225509277 AAACTGAGGGACACCGGGACAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062954682 10:1532470-1532492 CAGCAGAAGGACACAGGGACGGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063392403 10:5659145-5659167 CACCACAGGGAGCCTGGCACAGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065963459 10:30752711-30752733 CGCCAGAGGGACAGCAGGACTGG + Intergenic
1068358098 10:55937691-55937713 CAGGAGATGGAGACCAGGACTGG + Intergenic
1068954783 10:62813097-62813119 CAACAAAGGGAGAGAGGGACAGG + Exonic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069862063 10:71477825-71477847 CAGCAGAGAGAGAAAGGGACAGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074014294 10:109518035-109518057 CAGCAGAGGGAAACGGGGAGAGG + Intergenic
1076668960 10:132108646-132108668 CACCAGTGGGAGACAGGACCAGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078922451 11:15843320-15843342 CTCCAGAGAGAGACCAGTACTGG - Intergenic
1079321698 11:19456773-19456795 CACCAAAGGGAGAGCGAGAATGG - Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083592092 11:63901829-63901851 CACCAGAGGGAGAGCAGGGCAGG - Intronic
1083730194 11:64648657-64648679 CTGCAGAGGCAGACCGGGGCAGG - Intronic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086350109 11:85936033-85936055 CACCAGACTGGGACCGGGCCAGG - Intergenic
1086517447 11:87629147-87629169 CAGCAGATGGAGGCAGGGACTGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088238829 11:107753073-107753095 CATCAGATGGAGAACTGGACAGG + Intergenic
1088243250 11:107792315-107792337 CACCAGTGGGAAAGCAGGACTGG - Exonic
1089499146 11:118922581-118922603 CACCCCAGGGAGAGCGGGCCTGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091393515 12:139929-139951 GACCCCAGCGAGACCGGGACTGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1097720190 12:63011667-63011689 CACCAAAGGAAGACCAAGACTGG - Intergenic
1097990373 12:65826013-65826035 CGCCGGAGGGAGCCCGGGGCAGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101509281 12:105378327-105378349 AGCCAGAGGAAGACTGGGACAGG + Intronic
1102015607 12:109645998-109646020 CACCAGTCGGAGACGGGGAAAGG + Intergenic
1103322985 12:120102482-120102504 CACCAGGGCGACCCCGGGACTGG + Intronic
1104652695 12:130548035-130548057 CACCAGAGGGTGACCAGGGCAGG - Intronic
1104894895 12:132159268-132159290 CACCACAGAGACACTGGGACTGG - Intergenic
1106050768 13:26187482-26187504 CACCAGAGGGGGCCAGGGAAGGG - Intronic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1111459398 13:88519904-88519926 CAGCAGAGGGACCCTGGGACTGG - Intergenic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1113906976 13:113823859-113823881 CATCGGAGGGAGGCAGGGACAGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115028027 14:28765949-28765971 CACCGCGGGGAAACCGGGACTGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1121008918 14:90508562-90508584 CACCAGAGGAAGGCAGGGCCCGG - Intergenic
1121650500 14:95554506-95554528 AGCCAGAGGGACACTGGGACTGG + Intergenic
1122036014 14:98949916-98949938 CACAAGAGAGGGGCCGGGACAGG + Intergenic
1122347706 14:101070792-101070814 GACCAGAGGGGGACTGGGAATGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1125744722 15:41990439-41990461 CACCAGACAGGGGCCGGGACTGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127940516 15:63690634-63690656 AACCAGAGGGATACCTGGAGGGG + Exonic
1129292507 15:74579126-74579148 GTCCAGTGGGAGACAGGGACGGG + Intronic
1130542231 15:84828486-84828508 CTCCAGAGGGAGCCTGGGCCTGG - Intronic
1131076856 15:89500786-89500808 CAGCAGAGGGAGACAGAAACTGG - Intergenic
1132342390 15:101086717-101086739 CACATGAGTGAGACCGGGACTGG - Intergenic
1133924371 16:10181802-10181824 GACCGGAGGGAGAGCGGGAGAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140673384 16:77301602-77301624 CACCCGAGGGAGACAGAGCCAGG - Intronic
1141671064 16:85491936-85491958 CACCAGGCGGGGACAGGGACAGG - Intergenic
1141751741 16:85962782-85962804 CCCAAGAGAGAGAACGGGACAGG - Intergenic
1142012373 16:87722321-87722343 CTCCTGAGGGAGCCTGGGACGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144409866 17:14990536-14990558 CACCAGTGGGAGACTGGGGTGGG - Intergenic
1144760868 17:17706556-17706578 AGCCAGAGGGAGCCGGGGACTGG + Intronic
1145933063 17:28699801-28699823 CTCCAGAGGGATTCCGGTACCGG + Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146456899 17:33015652-33015674 CAGCAGGGGGAGAACTGGACAGG - Intronic
1146656063 17:34635987-34636009 CACCTGAGGCAGAGCGGGACCGG - Exonic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152411618 17:80127069-80127091 CAACACTGGGAGACCGGGACAGG + Intergenic
1152582575 17:81173087-81173109 CACCAGGGTGAGACCAGAACAGG - Intergenic
1152617775 17:81345842-81345864 CACCAGAGGGACCCCGCGGCGGG + Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1160906529 19:1454023-1454045 CAGCAGAGGGAGGCAGGGTCTGG + Intronic
1160955302 19:1688548-1688570 GACCAGGTGGAGACGGGGACAGG + Intergenic
1161062598 19:2222608-2222630 GACCAGAGGGAGACCGGGCGCGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163144920 19:15373676-15373698 CCCAAGAGGGAGGCGGGGACAGG + Intronic
1163936056 19:20445146-20445168 GACAAGAGAGAGACAGGGACTGG - Intergenic
1163991583 19:21003536-21003558 CACCAGAAGGAAGCCTGGACAGG + Intergenic
1165098535 19:33424234-33424256 CACCAGAGGCAGAACTTGACTGG + Intronic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166266087 19:41685385-41685407 CCCCAGTGGGAGACTGAGACAGG - Intronic
1166374189 19:42317903-42317925 CCCGAGAGGGAGGCAGGGACAGG - Intronic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168269165 19:55240298-55240320 CAGCTGCGGGAGAGCGGGACAGG + Exonic
1168349825 19:55669384-55669406 GAGCAGAGGGAGACTGGGTCTGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927787433 2:25983064-25983086 GGCCAGAAGTAGACCGGGACAGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928307350 2:30181068-30181090 CAACAGGGGGAAAGCGGGACTGG + Intergenic
928466500 2:31527655-31527677 CACCAGAGGCAGAGCGGGAATGG - Intronic
928542368 2:32295039-32295061 CATCAGAGGGAGAGGGGGAGGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929066651 2:37982509-37982531 CACCAGAGGGAGGAAGAGACTGG - Intronic
929663693 2:43816312-43816334 CAGCAAAGGAAGACCGTGACAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
932672989 2:73754282-73754304 CATCACAGGGAGACAGGGTCAGG - Intergenic
933627656 2:84619888-84619910 CACCAGAGGGAGAAAGGGTGAGG + Exonic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935953693 2:108353640-108353662 CCCCAGAGGGACACAGGGAGGGG - Intergenic
937288421 2:120767435-120767457 CACCAGCGGCAGACTGGGAGAGG - Intronic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948293944 2:236847273-236847295 AGCCAGAGGGAGGCAGGGACCGG + Intergenic
948335439 2:237203500-237203522 TATCAGAGGGAGACCTGGATTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169944930 20:10978436-10978458 CTCCAGAGTGAGACCAGGAGAGG + Intergenic
1171251579 20:23653101-23653123 CACCATAGGGAGGCAGGGCCTGG - Intergenic
1173430994 20:42987113-42987135 CAACAGAGGGAGGCAGGGAGGGG - Intronic
1173509130 20:43612400-43612422 CACCAGAGGGAGGCCAGGCCCGG + Intronic
1175844131 20:62049721-62049743 CTCCAGAGGGAGGCAGGGCCCGG + Intronic
1175882422 20:62268385-62268407 CACCAGGAGGGGACAGGGACAGG - Intronic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1175994364 20:62805465-62805487 CACCTGCGGGAGCCCGGGGCGGG + Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1176994165 21:15534789-15534811 CACAAGACGGAGACTAGGACTGG - Intergenic
1177120600 21:17132834-17132856 CAGCAGAGGGAAACTGGGTCAGG + Intergenic
1179885368 21:44312021-44312043 CACCAGAGGGACCCCAGGACTGG - Intronic
1180186656 21:46143366-46143388 CACAAGAGGGAGATGGGGAGGGG - Intronic
1180727649 22:17958540-17958562 AACCAGAGGGAGCCCTCGACAGG + Intronic
1180968189 22:19801335-19801357 CACCAGAGTGAGACCTGGACAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182043312 22:27255115-27255137 TGCCAGAAGGAGACTGGGACAGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183288960 22:36986406-36986428 CACCAGGGGGCGATCTGGACTGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
951118375 3:18892473-18892495 CACCAGAGAGAGAGAGGGAGAGG - Intergenic
954196848 3:49002122-49002144 CACCAGGGGGAGACCTGGTTAGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954621964 3:52001597-52001619 CCCCAGAGGGAGATCAGGCCTGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961740036 3:129027404-129027426 CACCTGACGGAGCCCGGGCCGGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964667409 3:159189511-159189533 CACTAGAGGGAGATGGTGACAGG + Intronic
966055239 3:175678954-175678976 CAGCAAAGGGAGACAGGGATGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967736428 3:192957449-192957471 CACAACAGGGAGACAGTGACAGG + Intergenic
967876719 3:194272594-194272616 GCCCACAGGGAGAGCGGGACAGG - Intergenic
968108317 3:196019923-196019945 CACCAGGGGCAGAGCTGGACGGG + Intergenic
968473121 4:791052-791074 CAGGAGCGGGAGACGGGGACAGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968898232 4:3417592-3417614 CACCAGAGCGACGCCAGGACGGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970590107 4:17552675-17552697 CCCCAGGTGGAGACCGGGTCTGG - Intergenic
971753285 4:30678187-30678209 CAGCAGAGGGAGCCTGGGCCCGG - Intergenic
972274876 4:37547579-37547601 CACCAGAAGGAAGCCTGGACAGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972995077 4:44869866-44869888 CACCAGAGGGAGGCCTGGTTGGG - Intergenic
973015768 4:45135117-45135139 CAGCAGAGGGAGCCTGGGCCTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975768869 4:77699334-77699356 AACAAGAGAGAGACCAGGACTGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979864083 4:125731478-125731500 CACCAGAAGGAGGCCAGGGCTGG - Intergenic
980072783 4:128261163-128261185 CATCAGAAGGAAACCTGGACAGG + Intergenic
980512507 4:133812483-133812505 CACCAGTGAGAGAGTGGGACTGG + Intergenic
980803155 4:137779318-137779340 CAGAAGAGGGAGGCAGGGACCGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982431222 4:155324135-155324157 CACCATGGGGAGGCCTGGACTGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985581242 5:696227-696249 CTGCAGTGGGAGACCAGGACAGG + Intergenic
985595867 5:787559-787581 CTGCAGTGGGAGACCAGGACAGG + Intergenic
989028023 5:37088711-37088733 CACCACAGGGAGCACAGGACTGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992821672 5:80504011-80504033 CAAGAGAGGGAGACCTGGCCTGG - Intronic
994593791 5:101806458-101806480 AACCAGAGGGAGCCAGGAACTGG + Intergenic
996899982 5:128533497-128533519 TACCAGAGGGAGAGGGAGACAGG + Intronic
998885615 5:146690979-146691001 CACCAGAGAGAGACTGGGGTAGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1002081884 5:176742292-176742314 CACCAGGGTGAGGCAGGGACAGG - Intergenic
1002394309 5:178941320-178941342 CCGCAGAGGGAGAGCGGGAGCGG + Exonic
1002600623 5:180352543-180352565 CACGAGAGGGAGTCCGGGGCGGG - Intronic
1002929210 6:1621679-1621701 CAGCAGAGAGAGCCCGCGACGGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1006294597 6:33164522-33164544 CCTCAGAGGGAGACAGAGACGGG + Intronic
1006829047 6:36957939-36957961 CAACAGTGGGAGACTGGGAGTGG - Intronic
1006985585 6:38173448-38173470 CATCAGAGGGCTACCGGGGCAGG - Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1010162076 6:72868459-72868481 AACCAGAGGGAGTCTGGGAGTGG + Intronic
1012390287 6:98730266-98730288 ACCCAGAGGGAGACAGGGAAAGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1018927624 6:168217444-168217466 CACCAGCAGGAGACCTGGAAGGG - Intergenic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019207516 6:170375090-170375112 CAGCAGAGGGAGCCCTGAACTGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019479123 7:1258123-1258145 CTGCAGAGGGAGCCCGGGCCTGG + Intergenic
1019612700 7:1944985-1945007 AAGCAGAGGGAGACGGGTACGGG + Intronic
1019637673 7:2084758-2084780 CACCAGAGCCAGACTGGGGCAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1020082158 7:5291880-5291902 CACCAGCAGGAGACCAGGGCTGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026878423 7:73893256-73893278 CACCTGATGGAGACCCGGTCTGG - Intergenic
1027225946 7:76243749-76243771 CCACAGAGGGAGACAGAGACTGG - Intronic
1032782242 7:135172646-135172668 CACCAGAAGGAAGCCTGGACAGG + Intergenic
1033118262 7:138645219-138645241 CACCAAAGGGTGACAGGAACAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034550034 7:151814647-151814669 CAACAGATGGGGACCGGGGCTGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035054680 7:156026688-156026710 CACCAGAAGGCGACCGGGAGGGG - Intergenic
1037436804 8:18871625-18871647 AACCAGAGAGAGACAGGGAAAGG - Exonic
1037524758 8:19713861-19713883 CCCCAGATGGAGAAGGGGACTGG + Intronic
1037711785 8:21360908-21360930 CACTAGAGGGAAACCAGGAAAGG - Intergenic
1037825862 8:22160217-22160239 CTCCAGATGGAGAGGGGGACAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041460728 8:58108761-58108783 GAAAAGTGGGAGACCGGGACAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045958916 8:107943916-107943938 GAACAGAGGGAGAGGGGGACGGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047410515 8:124620971-124620993 CCCCAGAGGGATACCAGGAAGGG - Intronic
1048440290 8:134454628-134454650 CGCCACAGGGAGAACGGCACTGG - Intergenic
1048476158 8:134743942-134743964 CACGAGAGGGTGACAAGGACAGG + Intergenic
1049149788 8:141027183-141027205 CAGCAGAGGGAGACAAGGCCAGG + Intergenic
1049800860 8:144516980-144517002 GACAAGAGGGCGACCCGGACCGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1055715029 9:79108480-79108502 CACCAGAGGGACCCTGGGCCTGG - Intergenic
1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG + Intronic
1057684939 9:97222708-97222730 CAGCAGAGGAAGACCGGGTCAGG - Intergenic
1059414636 9:114155446-114155468 CAGCAGAGGGCGGCCGGGAGCGG + Intergenic
1060995449 9:127872959-127872981 CACTGGAGGGAGCCCGGGCCTGG - Intronic
1062331444 9:136046559-136046581 CACCTGATGGGGACCGAGACGGG + Intronic
1062638008 9:137501563-137501585 CACCAGAGGAGGGCCTGGACTGG - Intronic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1186361965 X:8851788-8851810 AACCAGAGGGAGGCCGGGCATGG + Intergenic
1187833849 X:23410600-23410622 GACCAGAGGAAGACAGGGAAAGG - Intergenic
1188085234 X:25895213-25895235 CACCTCAGGGAGCCCAGGACTGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190178069 X:48167747-48167769 CACCAGAGGGAGAAGGTGCCAGG + Intergenic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1198249699 X:134868122-134868144 CAGCAGAGTGAGACCGGGTGCGG - Intergenic