ID: 1140052023

View in Genome Browser
Species Human (GRCh38)
Location 16:71489700-71489722
Sequence GACACAAGGGTCTTCCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140052023 Original CRISPR GACACAAGGGTCTTCCTCAA TGG (reversed) Intronic
901515314 1:9741336-9741358 AACACAAGGGTCTTCCTAGGAGG + Intronic
904018729 1:27444572-27444594 TACACAAAGGTGTTCCTAAATGG + Intronic
905006714 1:34715877-34715899 GAGACAAGGGCCTTGCTCAGTGG + Intronic
905292779 1:36934166-36934188 GACACAAGGCTCTTCCACTCTGG + Intronic
906486529 1:46239806-46239828 ATCACAAGGGTCCTCATCAATGG - Intergenic
907611985 1:55880280-55880302 AACACAATGTTCTTCCTCCAGGG - Intergenic
908769252 1:67581368-67581390 GACACAAAAGTCTTCCAGAAAGG + Intergenic
915274962 1:154782181-154782203 CACAGAAGGAGCTTCCTCAAAGG + Intronic
915306659 1:154983770-154983792 AAGACTAGGGTCTTCCTCGAAGG + Exonic
920208060 1:204307500-204307522 GACACCAGAGTCTTCCTGGAAGG - Intronic
922123159 1:222695190-222695212 GCCACAATGGTCTTCTTAAAGGG - Intronic
1063912411 10:10844894-10844916 GTTACAAGGTTCTTTCTCAAAGG - Intergenic
1064309757 10:14201809-14201831 GACACGAAGGTCTTCCTTTATGG - Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065131365 10:22623414-22623436 GTCGCAAGGGTCTTCCACAAGGG + Intronic
1066957041 10:42182994-42183016 CACACAATGGTCTTCCCCTAAGG + Intergenic
1074978581 10:118600802-118600824 GACAAAAGGCACTTGCTCAAAGG - Intergenic
1075283671 10:121164037-121164059 GACACATGGGTCTCCTGCAAAGG + Intergenic
1078770113 11:14341635-14341657 GACACAAGTGTTTTCTTCAGGGG - Intronic
1079282087 11:19096709-19096731 GACACAAAGGTGTTAATCAAAGG + Intergenic
1082645925 11:55725272-55725294 GCCACAAGGCATTTCCTCAATGG - Intergenic
1085743927 11:79098936-79098958 GATAGAAAGGTCTCCCTCAAAGG + Intronic
1087932653 11:103996158-103996180 GACACAAGGAAGTTCCTCCAAGG - Exonic
1090887801 11:130894546-130894568 AACAAACAGGTCTTCCTCAAAGG + Intronic
1091906338 12:4192483-4192505 GACACCTGGGCCTTCTTCAAGGG - Intergenic
1095593328 12:43930887-43930909 GAGGCCAGGGTCTTCCTGAATGG + Intronic
1096128592 12:49138870-49138892 AACAAAAGGGACTTCCTCAACGG - Intergenic
1096185998 12:49580966-49580988 GACCCCAGGGCCTGCCTCAAGGG + Intronic
1097158346 12:57028607-57028629 GGGACAAGGGTCCTCTTCAAGGG + Exonic
1097725913 12:63075915-63075937 GAGATAAGGGACTTCTTCAAAGG - Intergenic
1098141828 12:67457721-67457743 GACACAAAGGCCATCCACAAGGG + Intergenic
1100218578 12:92479551-92479573 GATACCATGCTCTTCCTCAATGG + Intergenic
1101749989 12:107575729-107575751 ATCACAAGGGTCTTTATCAAAGG - Intronic
1104027312 12:125037468-125037490 GACAGATGGGACTTCCTCCAGGG - Intergenic
1106788464 13:33130257-33130279 GATACAAAGATCTTCCTCATCGG + Exonic
1119287341 14:73466378-73466400 GACATCAGTGTCTTCCTCATTGG + Intergenic
1121848778 14:97199945-97199967 AACAAAAGGGTCTTACTGAAGGG - Intergenic
1202936069 14_KI270725v1_random:88782-88804 CACACAATGGTCTTCCCCTAAGG - Intergenic
1125087312 15:35745409-35745431 CAAACAAGTGTATTCCTCAAGGG - Intergenic
1126304865 15:47244272-47244294 GTCACAAAGTTCTTGCTCAATGG - Intronic
1138062269 16:53904430-53904452 GACAGATGGGTGTTCCTCATGGG - Intronic
1139210347 16:65071080-65071102 GGCACCAGGGAGTTCCTCAAAGG - Intronic
1140052023 16:71489700-71489722 GACACAAGGGTCTTCCTCAATGG - Intronic
1140142594 16:72272844-72272866 GACACAGGGGTCTTCTCCCATGG + Intergenic
1141810100 16:86370289-86370311 AGCACAGGGGTCTCCCTCAATGG - Intergenic
1143757066 17:9074936-9074958 CACACACGGGTCTTACCCAACGG + Intronic
1143975044 17:10823409-10823431 GACACAAGTGCTTTCCTCCATGG + Exonic
1144922465 17:18775840-18775862 GAGACAAGGGTCTTGCTAAGTGG - Intronic
1149626097 17:58082265-58082287 TACAGAAGTGTCTACCTCAAGGG - Intergenic
1151631020 17:75310900-75310922 GAGACAAGAGTCTTGCTCCATGG - Intergenic
1155657014 18:28204369-28204391 GACCCAAGGCACTTCCTCAAAGG + Intergenic
1160366936 18:78334597-78334619 AACAGAAGGGTTTTCATCAAGGG - Intergenic
1163522467 19:17799654-17799676 GTCAGAAGGCCCTTCCTCAACGG + Intronic
925460514 2:4058968-4058990 GAGACTAGGTCCTTCCTCAAGGG + Intergenic
925555146 2:5122533-5122555 GACTCCAGGGTCTTCATCAGTGG - Intergenic
925784842 2:7421922-7421944 TTCACAAGTGTGTTCCTCAAAGG + Intergenic
925982036 2:9184736-9184758 GTCTCAAGTGTCTGCCTCAAGGG + Intergenic
928090645 2:28372463-28372485 GACACAGGAGTCTGCCTGAAGGG + Intergenic
933538557 2:83609102-83609124 GACAAAAGGGTTTTCTTCTAGGG + Intergenic
934247247 2:90318130-90318152 CACACAATGGCCTTCCTCTAAGG - Intergenic
934985435 2:98881605-98881627 GACACGAGGGTCACACTCAAAGG - Intronic
936462702 2:112724229-112724251 CACACTCAGGTCTTCCTCAAAGG - Intronic
937971503 2:127552610-127552632 GACACCAGGATCTGCCTCACAGG - Intronic
944114863 2:196174882-196174904 GGTACAAGTGTCTTCCTTAAAGG + Intronic
946587847 2:221210377-221210399 GATACTAGGGTCTACCTGAAGGG + Intergenic
946965691 2:225035088-225035110 GAGAGAAGGGACTTCATCAAGGG + Intronic
947931535 2:233968818-233968840 GACAGAAGGGACTTTCACAAAGG - Intronic
1169301396 20:4444847-4444869 GAAACAAGGGCCATCATCAATGG - Intergenic
1171046635 20:21814241-21814263 GAGGCAAGGGTCACCCTCAACGG - Intergenic
1171289553 20:23974165-23974187 GCCACTAAGGTCTTCCTCACAGG - Intergenic
1172296270 20:33813229-33813251 GACACAAGGGTCTCTCTCTTCGG - Intronic
1177679136 21:24341411-24341433 GACACCAGGGTCTACTTGAATGG + Intergenic
1180280418 22:10688462-10688484 CACACAATGGTCTTCCCCTAAGG - Intergenic
950574837 3:13825983-13826005 CACACAAGGCTCTTCATCAGAGG - Intronic
955326043 3:58009785-58009807 TACACCAGGGTCTTCCTGAAAGG + Intronic
958707203 3:97670891-97670913 GACACCAAGGCCTTCCACAAAGG + Intronic
960777011 3:121267978-121268000 GCCACAACTGTCTTCCCCAATGG - Intronic
967184800 3:186935166-186935188 GACACCAGGGCCTTCTTGAAGGG - Intronic
972460126 4:39294015-39294037 ATCACAAGGGTCTTCATAAAGGG - Intronic
974762422 4:66294619-66294641 GACACTGGGGTCTACCTGAAGGG - Intergenic
975267684 4:72390388-72390410 AAGACAAGTGTCTTCCTCACTGG - Intronic
975406281 4:73994385-73994407 TATAAAAGGGTCCTCCTCAAAGG + Intergenic
980134020 4:128843177-128843199 AACACAAGTGTCTACCTCATAGG + Intronic
980911341 4:138997465-138997487 GAATCAAGGGTCTTCCTGGATGG + Intergenic
983782347 4:171685792-171685814 CACACAAGGGAATTCCCCAAAGG - Intergenic
987066008 5:14290239-14290261 TACACAAACGTCTTGCTCAAGGG - Intronic
987865908 5:23538354-23538376 GACACTAGGGTCTACTTCAGTGG - Intergenic
992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG + Intergenic
996230011 5:121051495-121051517 GTTACAAGGGTCTTTCTGAAAGG + Intergenic
997379568 5:133426006-133426028 GAGAGAAGGGTCTTGCTCAGGGG - Intronic
997409550 5:133680673-133680695 GAGACAAGGCTCTTCCTTATAGG + Intergenic
999285607 5:150392619-150392641 GAGACCAGGGCCTTCCTGAAGGG + Intronic
1001042525 5:168347153-168347175 GTGACAAGGGTCCTCCTCAGAGG + Intronic
1001168358 5:169392338-169392360 GCCACAGGGGTCTTCCCAAAGGG - Intergenic
1008640850 6:53461267-53461289 GCCATAAGGGGCTTCCTTAAGGG - Intergenic
1008698116 6:54065592-54065614 GAGGCAAGGGTCTTCCTTAGAGG - Intronic
1009436156 6:63620741-63620763 CACACAAAGGACTTCCTCAGTGG + Intergenic
1009474277 6:64068950-64068972 GACACAAGTGTCTTTGTAAAAGG + Intronic
1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG + Intronic
1015676813 6:135759913-135759935 GACAAAATCCTCTTCCTCAAAGG - Intergenic
1015732539 6:136363159-136363181 GACAAAAGGGTCCTCTTCATAGG - Intronic
1017006836 6:150033552-150033574 CACACAAGGGTGTACTTCAACGG - Intergenic
1019361077 7:604445-604467 GACACAAAGGTCTGCCCCAGAGG + Intronic
1020969237 7:14913448-14913470 GACACAATTTTCTTACTCAAAGG - Intronic
1021960735 7:25870661-25870683 AACAAAAGTGTGTTCCTCAAAGG - Intergenic
1023149480 7:37187858-37187880 GACACAAGGCCATTCTTCAAGGG + Intronic
1024343168 7:48287300-48287322 TCCACAAGGCTCTTCCCCAAAGG - Intronic
1029906923 7:104101813-104101835 GGGACCAGGGTTTTCCTCAAGGG + Intergenic
1034468380 7:151243057-151243079 AACACAAGGCACTTCCTAAAGGG - Intronic
1041173206 8:55166497-55166519 GACAAAAGTGTCTGCCTTAATGG + Intronic
1041211063 8:55551624-55551646 GACACTAGGATCTTCCTTGAGGG + Intergenic
1043551223 8:81375218-81375240 GACATAAGTGTGTTCCTCTAAGG - Intergenic
1045813249 8:106249326-106249348 GACACGAGGGTCTACCTGAGGGG + Intergenic
1047017088 8:120735246-120735268 GACACAAGGGACTTCCATAAGGG + Intronic
1049584976 8:143428823-143428845 GAAAGAAGGGGCTTCCTCCAAGG + Exonic
1049685383 8:143937328-143937350 GAGCCAAGGGTCTTCCCCAGGGG + Intronic
1052103150 9:24476088-24476110 TACACAATGGTATTCCACAAAGG - Intergenic
1053099221 9:35355907-35355929 GACACAAGTGTCCTCATCATTGG - Intronic
1053696559 9:40644599-40644621 CACACAATGGTCTTCCCCTAAGG - Intergenic
1054307809 9:63443827-63443849 CACACAATGGTCTTCCCCTAAGG - Intergenic
1054406534 9:64767829-64767851 CACACAATGGTCTTCCCCTAAGG - Intergenic
1054440164 9:65253302-65253324 CACACAATGGTCTTCCCCTAAGG - Intergenic
1054490241 9:65768637-65768659 CACACAATGGTCTTCCCCTAAGG + Intergenic
1054715765 9:68556467-68556489 TACACAATGGACTTCCTCAGGGG + Intergenic
1056815667 9:89799086-89799108 CTCACAAGGATCTTCCTCTAGGG + Intergenic
1058859483 9:109100934-109100956 AACCCAAGGGTCTTACTCAGTGG - Intronic
1059035749 9:110752004-110752026 GACAAAAGGGTCTTATTCCAGGG - Intronic
1059975602 9:119713534-119713556 GACACTGGGGTTTACCTCAAGGG - Intergenic
1202779009 9_KI270717v1_random:18259-18281 CACACAATGGTCTTCCCCTAAGG - Intergenic
1203586078 Un_KI270747v1:4668-4690 CACACAATGGTCTTCCCCTAAGG - Intergenic
1186326707 X:8485669-8485691 GACACAAATGGCTTCTTCAATGG - Intergenic
1193824089 X:86201269-86201291 GACACCAGGGTCTTCTTGAGGGG + Intronic
1194707235 X:97190498-97190520 GACATAAGGGTCAGCCTCACTGG + Intronic
1198293994 X:135266837-135266859 GACACATGGATCATTCTCAAGGG + Intronic
1198605061 X:138328511-138328533 GCCAAAAGGGTCTACCTAAAAGG - Intergenic
1201194303 Y:11476533-11476555 CACACAATGGTCTTCCCCTAAGG - Intergenic