ID: 1140055493

View in Genome Browser
Species Human (GRCh38)
Location 16:71522027-71522049
Sequence AATTGTCCCAGGAGTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140055493 Original CRISPR AATTGTCCCAGGAGTAGAGT TGG (reversed) Intronic
906240796 1:44241024-44241046 GATTGTCCCATGAGTACTGTGGG + Intronic
909214101 1:72863615-72863637 AATTGTCCCAGCAGTGATGTGGG - Intergenic
910757688 1:90709394-90709416 TATTGTCCCAGGAAGAAAGTTGG - Intergenic
913045778 1:115072525-115072547 TATTGCCCCTGGAGTAAAGTGGG - Intronic
915897484 1:159823287-159823309 ACTTCTCCCAGGAGGAGAGATGG - Intergenic
916168489 1:161983713-161983735 CATTGTCCCAGGCATAGAGCAGG + Exonic
917439879 1:175058174-175058196 AATTGTCCCAGGAGCATTTTTGG - Intergenic
919934365 1:202241751-202241773 GCTGGTCCCAGGAGAAGAGTTGG + Intronic
921757625 1:218878676-218878698 AATTTTCCCAGGAGTACATTTGG - Intergenic
924240713 1:242037578-242037600 AAAAGTCACAGGAGCAGAGTGGG + Intergenic
1066191450 10:33059687-33059709 AATTGACCCTGGCATAGAGTTGG - Intergenic
1066497367 10:35955266-35955288 TATTGCCCCAGGTGTAGAGGGGG - Intergenic
1070675821 10:78410565-78410587 CAGTGTCTCAGGAGGAGAGTGGG + Intergenic
1072365837 10:94708288-94708310 AATTGACCTAGCAGTAGAGAAGG - Intronic
1072818317 10:98531270-98531292 ACTTGTTCCAGGAGGAGAATGGG + Intronic
1073273846 10:102290835-102290857 AATAGTCCCATAAGTAGAGTGGG + Intronic
1073285534 10:102385334-102385356 AATTTTCCCAGGGGCAGGGTTGG - Intergenic
1073513206 10:104055589-104055611 AGTTTTTCCAGGAGTAAAGTGGG + Intronic
1073645993 10:105304584-105304606 AATTGTCTCAGGAATAGAGGTGG - Intergenic
1073959402 10:108909251-108909273 TGTTTTCCCAGGAGTAGAGTGGG - Intergenic
1074461598 10:113643094-113643116 AAATGTCCCAGGACTTGACTAGG + Intronic
1076042520 10:127262877-127262899 AATTTTCCCATGTGTAAAGTGGG - Intronic
1077187818 11:1243326-1243348 AGTTGTCCCAGGAGTTGAGGAGG - Exonic
1077188773 11:1247097-1247119 AGTTGTCCCTGGAGTTGAGGAGG - Exonic
1077754050 11:5006221-5006243 ATTTGTACCAGGAGTGGAGTGGG + Intergenic
1080778050 11:35404463-35404485 AGTTGTCCCAGGTGTAGCCTTGG + Intronic
1081191344 11:40105619-40105641 AATTGTTCCAGGTGAAGATTGGG - Intergenic
1081396275 11:42589986-42590008 TATTTTCCCAGGAGAAGAGTAGG - Intergenic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1083690422 11:64404919-64404941 AATTGCCTTAGGAGAAGAGTTGG - Intergenic
1084075834 11:66775422-66775444 AAATCTCCCAGGAGAAGAGCAGG - Intronic
1084115134 11:67038582-67038604 AAGTGTCCCAGAAGAAGAATGGG - Intronic
1084526055 11:69698652-69698674 AGTTGTCCCAGGGCTGGAGTGGG + Exonic
1085471075 11:76758501-76758523 TATATTCCCAGGAGTAGACTTGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088510699 11:110571024-110571046 CATTGTCCCAGGATGAGTGTGGG - Intergenic
1088536593 11:110868148-110868170 ACTAGTCCCAGGAGTAGAACTGG + Intergenic
1089565916 11:119371692-119371714 ATTTGTCCTAGGAGTAGGGAGGG + Intronic
1091081554 11:132673791-132673813 AATTTTCCCAGAAGCAGAATTGG + Intronic
1092681944 12:10992964-10992986 CATTGTCCAAGGAATAGAATTGG + Intronic
1093342979 12:18001355-18001377 AATTGTCCCAAGAGAAAATTAGG + Intergenic
1093932910 12:24972053-24972075 AATTGTCTCATAAGTAGAGGGGG + Intergenic
1096413539 12:51393676-51393698 CATTCTCCCAGGAGTAGAAAGGG + Intronic
1100174310 12:92012047-92012069 AATTTTGCAAGGATTAGAGTTGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102388080 12:112527650-112527672 AATTGGCTCAGGAGTAGACATGG - Intergenic
1107725911 13:43299029-43299051 ATTTGTCCCAGCAGTAGAGCAGG - Intronic
1110216524 13:73030347-73030369 AACTGCCCCAGGAATAGACTAGG - Intergenic
1114243764 14:20893414-20893436 GATTGTTCCAGGAACAGAGTGGG + Intergenic
1120702618 14:87714521-87714543 AAATGTCCCAGGAGGAGCATGGG + Intergenic
1121199519 14:92106105-92106127 AATTCTGCCAGGATTAGGGTAGG + Intronic
1121361958 14:93269862-93269884 ATTGGTCCCAGGAGGAGAATGGG + Intronic
1121619252 14:95334928-95334950 ATTTGCCCCAGGAGGAGGGTGGG + Intergenic
1121658887 14:95619970-95619992 AATTGTCCCATCAGTAAAATGGG - Intergenic
1127872659 15:63086425-63086447 ACTTTTCCCAGGGGTAGAGAAGG + Intergenic
1132267724 15:100490302-100490324 AATTGTCTCTGGAGAATAGTCGG + Intronic
1140055493 16:71522027-71522049 AATTGTCCCAGGAGTAGAGTTGG - Intronic
1142114159 16:88347801-88347823 AATGGTCCCAGGAGGCGGGTGGG - Intergenic
1144279219 17:13707993-13708015 GATTGAGCCAGGAGTAAAGTAGG + Intergenic
1148450734 17:47776362-47776384 AATGGGCCCATGAGCAGAGTGGG + Intergenic
1151160215 17:72158867-72158889 AATCGTCCCAGCAGGGGAGTGGG + Intergenic
1151238737 17:72741144-72741166 AATTGTTACAGTAGTACAGTGGG + Intronic
1154045708 18:10902936-10902958 AATTGTCCAAGGAATTGAATGGG + Intronic
1156514319 18:37667268-37667290 ACTTGTCTCAGGAATACAGTTGG + Intergenic
1157333424 18:46720173-46720195 AACTCTCCCAGGAGTCCAGTAGG + Intronic
1157386177 18:47261303-47261325 AACTTGCCCAGGAGGAGAGTAGG - Intergenic
1159191434 18:65049051-65049073 AATTGGCCCAGTAATAAAGTTGG + Intergenic
925194571 2:1912829-1912851 AATTTTCCCAGCAGTGGTGTTGG + Intronic
925370334 2:3340275-3340297 CAATCTCCCAGGAGTAGAGCGGG + Intronic
926883197 2:17571604-17571626 AATTGTCCCTGGTGCTGAGTAGG - Intronic
929084216 2:38152123-38152145 AATTGTTCAAACAGTAGAGTAGG - Intergenic
929435378 2:41924869-41924891 TATTGCACCAGTAGTAGAGTGGG + Intergenic
930394221 2:50799851-50799873 AAGTGTCACAAGATTAGAGTTGG - Intronic
930684485 2:54293368-54293390 AAAGGTCCTAGGAGTAGAGAAGG - Intronic
931912318 2:66914128-66914150 AATTGTCCAGGGAGGAGAGTGGG + Intergenic
933266194 2:80182667-80182689 AATGGCCTCAGGAGAAGAGTTGG + Intronic
934057311 2:88262197-88262219 AATTCTCCCAGGAGAAAAGATGG + Intergenic
935708922 2:105880510-105880532 GAGTGTCCCAGGAGTGGAGGAGG + Intronic
940002192 2:148977379-148977401 ATTTGTCCCAGGAGAAGAGATGG + Intronic
940932099 2:159445181-159445203 ATTGGTTCCAGGAGTAGGGTGGG - Intronic
942952899 2:181741602-181741624 TATTATCCCAGGAGTAGAATGGG - Intergenic
944493382 2:200281963-200281985 TATTGTTCCAGGAGTAGGGGTGG + Intergenic
946049529 2:216850339-216850361 AGTTGCCCCAGGAGCAGAGAAGG - Intergenic
1169540520 20:6594620-6594642 AATTCTTCTAGGAGTAGAGAGGG - Intergenic
1171242944 20:23586254-23586276 AAATGTCCCAGGAGTGGGGCTGG + Intergenic
1172506977 20:35470187-35470209 AATTTCCCCAGGAATACAGTAGG - Intronic
1175742324 20:61428504-61428526 AATTGGACAAGGAGTAGAATAGG + Intronic
1177087049 21:16718832-16718854 TATTGTAGCAGGAGTGGAGTGGG - Intergenic
1177254719 21:18646093-18646115 AATGTTCCCAGTAGTAGAGAGGG - Intergenic
1177667378 21:24178598-24178620 GAATGTACAAGGAGTAGAGTAGG + Intergenic
1180990734 22:19934197-19934219 AACTGTCCCAGGCTTGGAGTGGG - Intronic
1183010354 22:34941375-34941397 ATTAGTTCCCGGAGTAGAGTAGG + Intergenic
1183719744 22:39555783-39555805 AAATGTCCCTGGAGGAGAATGGG + Intergenic
951174139 3:19579417-19579439 CATTCTCCTAGGAGTTGAGTTGG - Intergenic
951246304 3:20345423-20345445 AAATTACCCTGGAGTAGAGTAGG - Intergenic
952695840 3:36264428-36264450 AATTGACCAAAGAGTAGAGATGG + Intergenic
956242396 3:67144952-67144974 AATTGGCCTATGAGTAGTGTAGG - Intergenic
956420806 3:69085065-69085087 AATCGTCCCAGGCGCGGAGTGGG - Exonic
961633027 3:128315172-128315194 AATTTTCTCAGCAGTAAAGTGGG + Intronic
962199196 3:133387688-133387710 AATTGTCCCTGGTGCACAGTAGG - Intronic
966558481 3:181291362-181291384 AATTCTTCTTGGAGTAGAGTGGG + Intergenic
967942707 3:194778633-194778655 AAATGTCCCAAGAGAAGAGCTGG + Intergenic
972064684 4:34926298-34926320 ACTGGCCACAGGAGTAGAGTGGG + Intergenic
975557646 4:75680626-75680648 ATTTGTCCCAAGAGGAGAGTGGG - Intronic
976617963 4:87097226-87097248 AGCTCTCCCAGGAGTAGAGTGGG + Intronic
977088985 4:92645971-92645993 AAATGTCCTAGGAGTAGAATTGG + Intronic
979347360 4:119604401-119604423 TATGGTCCCAAGAGTACAGTAGG - Intronic
981624638 4:146741801-146741823 AGTTGTGACGGGAGTAGAGTAGG - Intronic
986521029 5:8618548-8618570 AATTGTCCCAGGTTTCAAGTAGG - Intergenic
986891287 5:12310350-12310372 ATTTGTGCCAGGAGGATAGTGGG - Intergenic
991772589 5:70053586-70053608 AATTATGACAGGAGTAGTGTTGG + Intronic
991851882 5:70929010-70929032 AATTATGACAGGAGTAGTGTTGG + Intronic
996065927 5:119079288-119079310 TATTGTACCAGGAGGAGAGAAGG - Intronic
996284043 5:121767970-121767992 AATTATCCCATGAGTAGACAGGG + Intergenic
1001301392 5:170536346-170536368 AGTTTTCCCAGCAGTAGAATGGG + Intronic
1003227836 6:4222596-4222618 ATTGGTACCAGTAGTAGAGTGGG + Intergenic
1003614928 6:7646379-7646401 AATTGTCCCACCAGGAGAGAGGG + Intergenic
1007316404 6:40992785-40992807 GATTTCCCCAGGAGCAGAGTGGG - Intergenic
1008499982 6:52170960-52170982 ATTCGTACCAGTAGTAGAGTGGG - Intergenic
1012323360 6:97880979-97881001 AAATGTCCCAGGAGTAGCAAAGG - Intergenic
1013597753 6:111675200-111675222 AACTATCCCAGGAGTAAAGATGG - Intronic
1015642414 6:135349884-135349906 ATTTGACAAAGGAGTAGAGTAGG - Intronic
1017045951 6:150347299-150347321 AGTTGTCCCAGGAGAGGAGGAGG - Intergenic
1021734374 7:23628671-23628693 ACTGGTCCCATGAGTACAGTGGG - Intronic
1024543276 7:50496749-50496771 AAGTTTCCCAGTAGGAGAGTCGG - Intronic
1024869038 7:53940443-53940465 AAATGTCCCAGGAGGGGACTGGG + Intergenic
1029686146 7:102149507-102149529 AAATGTCCCAGGGGAGGAGTGGG - Intronic
1031459194 7:122025090-122025112 TACTGTGCCAGGAGTAGAATAGG - Intronic
1031841937 7:126752857-126752879 TATTGTCAGAGGAGGAGAGTGGG - Intronic
1034103420 7:148470729-148470751 AATTCTCCCATGAGAAGAGTGGG + Intergenic
1034243353 7:149625886-149625908 AATTGCCCCAGGAGTCGTGTGGG + Intergenic
1035688641 8:1545170-1545192 AAGTCTCCCAGGACTAGAATAGG - Intronic
1036567261 8:9948212-9948234 AATTGTCCAAGGAGAAGAGCAGG - Intergenic
1041725048 8:61010521-61010543 AATTGGTCCAGGAGCAGACTAGG - Intergenic
1042017212 8:64327472-64327494 AATTGGCCCAGAAGGAGAGCAGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1047573771 8:126130910-126130932 AATGGTCCCTGGAGTGAAGTTGG + Intergenic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051407814 9:16757673-16757695 CATTGTACCAGGAATATAGTAGG - Intronic
1187084286 X:16025682-16025704 AATGGTCCCAGCAGGACAGTAGG - Intergenic
1195300226 X:103522780-103522802 AATTCTCACAGGAGTTTAGTAGG - Intergenic
1196315632 X:114219656-114219678 ATTTGACCCAGGATTAGAATGGG + Intergenic
1197127671 X:122966815-122966837 AACTGTCCTAGGAATTGAGTAGG + Intergenic
1198637911 X:138720094-138720116 AATAGTGCCCGGAGTAGAGTTGG - Intronic
1199305561 X:146263632-146263654 AATTGTTCCAAGAGTAAAGTAGG + Intergenic
1200157254 X:153983772-153983794 GACTGTCCCGGGAGTAGAGAGGG - Intergenic