ID: 1140055824

View in Genome Browser
Species Human (GRCh38)
Location 16:71524784-71524806
Sequence CCTAGCACGGGAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140055816_1140055824 25 Left 1140055816 16:71524736-71524758 CCAGAGGATGCCTTTCTTCAGCT 0: 1
1: 0
2: 1
3: 17
4: 212
Right 1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 107
1140055818_1140055824 15 Left 1140055818 16:71524746-71524768 CCTTTCTTCAGCTGCTTGGCATT 0: 1
1: 0
2: 3
3: 52
4: 534
Right 1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140055824 Original CRISPR CCTAGCACGGGAAAGATGGC AGG Intronic
902378419 1:16041368-16041390 CCAAGCACGGGACAGAGGTCGGG - Intergenic
904846770 1:33425324-33425346 CCTATCACAGGAAACAAGGCTGG + Intronic
905525742 1:38637817-38637839 CCTAGCACCTGAAAGATGGTAGG - Intergenic
905883863 1:41481331-41481353 CCTGGAAAGGGAAAGATGCCAGG - Intronic
908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG + Intronic
908760033 1:67503216-67503238 CCAAGCTGGGGGAAGATGGCAGG + Intergenic
913560035 1:120008802-120008824 TCTAGCACTGGAAAAATGCCTGG - Intronic
914280620 1:146168221-146168243 TCTAGCACTGGAAAAATGCCTGG - Intronic
914541663 1:148619161-148619183 TCTAGCACTGGAAAAATGCCTGG - Intronic
914624975 1:149452086-149452108 TCTAGCACTGGAAAAATGCCTGG + Intergenic
916208036 1:162334290-162334312 GCTACAACTGGAAAGATGGCAGG + Intronic
919750107 1:201032255-201032277 CCTAGCAAGGAAAAAATGGAAGG - Intergenic
920283546 1:204862189-204862211 CCAAGAATGGGAAAGATGGTGGG - Intronic
922337713 1:224631259-224631281 CCTAGCAAGGGAGGAATGGCAGG + Intronic
1070683199 10:78463357-78463379 CTGAGCACTGGAAATATGGCTGG + Intergenic
1071773287 10:88754373-88754395 CTTAGCAGGGGAAGGCTGGCTGG + Intergenic
1075801112 10:125153844-125153866 CCTGGGACGGGACAGATTGCTGG + Intronic
1083192099 11:61059551-61059573 CTGAGCACAAGAAAGATGGCAGG - Intergenic
1083708754 11:64534569-64534591 CCCAGGACGGGAAGGATGGAGGG - Intergenic
1085188365 11:74595812-74595834 ACCAGCATGGGAAACATGGCGGG - Intronic
1087398220 11:97630660-97630682 CCTAGCAAGGTAAAGTTAGCTGG - Intergenic
1087803565 11:102531259-102531281 CCATACAGGGGAAAGATGGCAGG + Intergenic
1088607750 11:111547798-111547820 CTTATCCAGGGAAAGATGGCAGG - Intronic
1092172240 12:6381199-6381221 TCTAGGCCTGGAAAGATGGCAGG + Intronic
1093889261 12:24499653-24499675 CCTAGCATTGGAAAGATGAAAGG + Intergenic
1103793423 12:123487453-123487475 CTTAGCCCGGGCATGATGGCGGG - Intronic
1106635449 13:31524344-31524366 CCAAACGCAGGAAAGATGGCAGG + Intergenic
1109712077 13:66175141-66175163 CCTAGCTCCTGAAAGATTGCTGG - Intergenic
1117338839 14:54776981-54777003 CCAAGTAAAGGAAAGATGGCTGG - Intronic
1123793069 15:23742708-23742730 TCTAGCCAGGGAAAGTTGGCAGG - Intergenic
1123943647 15:25228582-25228604 CCTGGCTCGGGCAAGATGCCTGG - Intergenic
1125275210 15:37981619-37981641 GCTAGCCAGGGAAACATGGCAGG + Intergenic
1126180979 15:45784828-45784850 CATATCACAGGAAAGATGACTGG - Intergenic
1128661932 15:69507835-69507857 TCTCTCACGTGAAAGATGGCAGG + Intergenic
1130087979 15:80794705-80794727 TTAAGCACGGGAAACATGGCAGG - Intronic
1131094278 15:89646009-89646031 CCTAGCAGGTGACAAATGGCAGG - Exonic
1134132854 16:11661377-11661399 CCAAGCACCGGAAACGTGGCTGG + Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG + Intronic
1141029219 16:80573223-80573245 CCCAGCACTCGAATGATGGCTGG + Intergenic
1144296194 17:13877202-13877224 CTTAGCACGGGAACTTTGGCTGG - Intergenic
1144356492 17:14451650-14451672 CCTTGCTGGGGAAAGATGTCTGG + Intergenic
1144574496 17:16420360-16420382 CCTCCCACTGGAAGGATGGCTGG + Intronic
1145738118 17:27247896-27247918 CCTAGGACTGAAAAGAGGGCGGG - Intergenic
1147751407 17:42736755-42736777 CCTAGCAGGGCAGAGATTGCAGG + Intronic
1148166435 17:45487114-45487136 CTTAGCAGGGGAAAGGTGACTGG + Intronic
1149231862 17:54544373-54544395 TCCAGCAGGGGAAAAATGGCAGG - Intergenic
1150397605 17:64833514-64833536 CTTAGCAGGGGAAAGGTGACTGG + Intergenic
1162757908 19:12871255-12871277 AAGAGCACGGGAAAGGTGGCGGG + Intronic
1163219026 19:15900953-15900975 CCTAGCATGAGGCAGATGGCTGG - Intergenic
1163229348 19:15989750-15989772 GCTAACAGGGGAAAGATTGCAGG - Intergenic
1163506366 19:17709412-17709434 CCCAGCACAGGAAAGTTGTCAGG + Intergenic
1165698186 19:37917207-37917229 CCGAGCACTTGAAACATGGCTGG - Intronic
926081067 2:9986902-9986924 ACCAGCATGGGAAACATGGCAGG - Intronic
927092245 2:19720881-19720903 CCAAGCAGGGGATAGATGGTTGG - Intergenic
927496241 2:23553730-23553752 CCCAGCACGGGGCACATGGCGGG - Intronic
928371173 2:30741276-30741298 CCAAGGACAGGAAGGATGGCAGG - Intronic
932341804 2:70967300-70967322 CCTAGGAAGGGAAAGAAGGGTGG + Intronic
933149473 2:78896547-78896569 CCTAGGACAGGAAAAATGCCTGG + Intergenic
933986562 2:87596651-87596673 CCCAGCACAGAAAAAATGGCAGG + Intergenic
934053834 2:88235020-88235042 CAGAGCACGGGAAATATCGCTGG + Intergenic
935101236 2:99997964-99997986 CAGAGCAGGGGAAAGAGGGCTGG - Intronic
936307275 2:111354150-111354172 CCCAGCACAGAAAAAATGGCAGG - Intergenic
937231722 2:120401750-120401772 CCTAGAACAGCAAAGATGGGAGG - Intergenic
938954645 2:136286551-136286573 CCTAGGAAGGGAAAGAGAGCCGG - Intergenic
945259669 2:207831906-207831928 CCCAGCAGGGGAAAGGGGGCTGG - Intronic
947133498 2:226954083-226954105 CACAGCACCGGAAACATGGCAGG - Intronic
947668302 2:231920677-231920699 CCTAACAGGGGACAGATGACAGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172375280 20:34434077-34434099 ACTAGCATGGGCAACATGGCAGG + Intronic
1174677310 20:52370832-52370854 CTAAGCACTAGAAAGATGGCAGG + Intergenic
1175258076 20:57658795-57658817 CATAGCACGGGCACGAGGGCAGG + Intronic
1175700904 20:61136382-61136404 CCTAGCAGGGAAAACATGTCAGG + Intergenic
1181465437 22:23108219-23108241 CCCAGCACGGGGTGGATGGCAGG - Intronic
1183453891 22:37911115-37911137 CCCAGCACGGGACAGCTGGCTGG - Intronic
1184254757 22:43280594-43280616 CGTAGCAGGGGAAAGGTAGCAGG - Intronic
950305729 3:11914411-11914433 AGTAGCACTGGAAAGGTGGCAGG + Intergenic
950338783 3:12223229-12223251 GTTAGCAAGGGCAAGATGGCTGG + Intergenic
955462115 3:59194850-59194872 TCTAAGAGGGGAAAGATGGCCGG + Intergenic
957297544 3:78352406-78352428 CATAGCATGGGAAAAATCGCTGG - Intergenic
958096586 3:88953474-88953496 CTTAGACGGGGAAAGATGGCAGG - Intergenic
964626640 3:158766101-158766123 TCAAGCATGGGAAAGGTGGCAGG + Intronic
965484028 3:169256749-169256771 CATAGGACAGGAAAGATGCCTGG + Intronic
966413872 3:179669551-179669573 CTTAGCCTGGGGAAGATGGCAGG - Intronic
966932937 3:184687481-184687503 CCTAGAACGGGAGGGATGGATGG + Intergenic
968477092 4:816627-816649 CCTAGCCTGGGAAACATGGTGGG + Intronic
975666342 4:76738874-76738896 CTTGGCAGGGGAAAGATGACAGG - Exonic
981273814 4:142874882-142874904 ACCAGCAGGGGAAAAATGGCAGG - Intergenic
987456167 5:18149850-18149872 CCCAGCACAGGAATGCTGGCAGG + Intergenic
989600048 5:43192452-43192474 CCTAGCAGAGGAAGGGTGGCGGG - Intronic
992297101 5:75336759-75336781 ACTAGCGCGGGAGAGATGGAGGG - Intronic
992953967 5:81889216-81889238 CCTAGAAAGGGAGAGATGGAAGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
999140541 5:149358359-149358381 CCTAGGACGGAAAAGAGGCCTGG + Intronic
1001665923 5:173433722-173433744 CCTAGTACAGGAAATGTGGCTGG + Intergenic
1002523853 5:179805423-179805445 CCTGACACGGGAGGGATGGCTGG - Intronic
1007479929 6:42142840-42142862 CCTAGTCCGGGAAAGGAGGCGGG + Intergenic
1008619738 6:53260032-53260054 CCCAGCACTGGCAAGATGCCTGG + Intergenic
1015888812 6:137948437-137948459 TCTAGGATGGGAAAGATGGAAGG - Intergenic
1017567712 6:155706311-155706333 CCTAGGACTGGAAAGAGGACAGG - Intergenic
1021446140 7:20735735-20735757 CCTTGCAGTGGAAAGCTGGCTGG - Intronic
1027313188 7:76968220-76968242 CCAAGCCCCAGAAAGATGGCTGG + Intergenic
1028522972 7:91752716-91752738 CCCAGCAGGGGAAAAATGGCAGG - Intronic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1036474572 8:9081521-9081543 CATATCAGGGGAAGGATGGCCGG - Intronic
1038491979 8:27977818-27977840 TCGAGCACAGGAAACATGGCTGG + Intronic
1038687371 8:29730651-29730673 CCTACCCCTGGAAACATGGCTGG - Intergenic
1046057895 8:109100093-109100115 CCTATCAGAGGAAACATGGCAGG - Intronic
1062124649 9:134853436-134853458 CTCAGCCTGGGAAAGATGGCAGG + Intergenic
1187690728 X:21863839-21863861 CCTTGCCTGGGAAAGACGGCAGG - Intronic
1198489050 X:137120062-137120084 CTTAGGCGGGGAAAGATGGCTGG - Intergenic
1201784272 Y:17757321-17757343 CCATGCACGGGAAGGAAGGCTGG + Intergenic
1201817281 Y:18148666-18148688 CCATGCACGGGAAGGAAGGCTGG - Intergenic