ID: 1140057468

View in Genome Browser
Species Human (GRCh38)
Location 16:71537648-71537670
Sequence GGAGACATTAAGGGCATCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140057468_1140057473 -8 Left 1140057468 16:71537648-71537670 CCAGGGATGCCCTTAATGTCTCC 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1140057473 16:71537663-71537685 ATGTCTCCCAGGCTTGGCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 190
1140057468_1140057476 11 Left 1140057468 16:71537648-71537670 CCAGGGATGCCCTTAATGTCTCC 0: 1
1: 0
2: 0
3: 4
4: 145
Right 1140057476 16:71537682-71537704 CTGGTCTTTGCCCTATGAAAAGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140057468 Original CRISPR GGAGACATTAAGGGCATCCC TGG (reversed) Exonic
900600213 1:3499631-3499653 GGAGCCATTCACGGCATCACAGG + Exonic
901023117 1:6264979-6265001 GGAGACACTAAGGGCATGGCGGG + Intronic
901387765 1:8922241-8922263 GGAGTAAGGAAGGGCATCCCGGG - Intergenic
902388835 1:16091140-16091162 GCAGAGATTTAGGGCACCCCTGG - Intergenic
903678236 1:25079964-25079986 AGAGACATTCAGGGGTTCCCTGG + Intergenic
904604688 1:31692021-31692043 GGAGGCATCAAGGGCGTGCCGGG - Exonic
905787626 1:40770670-40770692 GGAGAGAGTGAGGTCATCCCTGG - Intronic
912145271 1:106785996-106786018 GGAGAAATGAAGGACATCTCTGG + Intergenic
915553442 1:156648017-156648039 GGAGACATGGATGGCTTCCCCGG + Exonic
920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG + Exonic
920926166 1:210343739-210343761 TGAGACATTAACGAAATCCCTGG + Intronic
922405232 1:225305727-225305749 GGAGACATGAAGGGCTGCCGAGG + Intronic
923242269 1:232097390-232097412 GAAGACATAAAGGGCATGCGGGG + Intergenic
923425300 1:233862873-233862895 AGAGAATTTAAAGGCATCCCAGG + Intergenic
924776479 1:247116619-247116641 GGTGACAGCAAGGTCATCCCTGG + Intergenic
924776787 1:247117582-247117604 GGTGACAGCAAGGTCATCCCTGG + Intergenic
1063155701 10:3377320-3377342 GGATAGATTATGGGCATCCATGG - Intergenic
1064456521 10:15492308-15492330 GGGGACCTAAAGGGCACCCCTGG + Intergenic
1067723737 10:48750442-48750464 GAAGACAGGAAAGGCATCCCAGG - Intronic
1071263768 10:83945462-83945484 GGAGTCATGAAGACCATCCCAGG - Intergenic
1072541928 10:96405163-96405185 CCAGACATTAACAGCATCCCGGG + Intronic
1072870879 10:99118714-99118736 AAAGAAATAAAGGGCATCCCGGG + Intronic
1074048732 10:109863455-109863477 GGAGAAATTAAGAGGTTCCCAGG + Intergenic
1074680235 10:115898620-115898642 GGAGACCTTAAGGCCATAACAGG + Intronic
1081146843 11:39571702-39571724 GGAGTCAGTAAGAGAATCCCTGG + Intergenic
1081992459 11:47345256-47345278 GGTGGCATTCAGGGGATCCCTGG + Intronic
1090458734 11:126871030-126871052 GCAGACATCAAGAGCATCCACGG + Intronic
1096862543 12:54540237-54540259 GGAGACCTGGAGGGAATCCCAGG - Intronic
1098064622 12:66600878-66600900 GCAATCATTAAGGGCATCTCAGG + Intronic
1098445195 12:70559485-70559507 GAAGACAGTAAGTGCATCTCTGG + Exonic
1102209305 12:111113059-111113081 GAGGAAAGTAAGGGCATCCCAGG + Intronic
1102386603 12:112515465-112515487 GGAAACACTAAGGGCCTCCGGGG - Intergenic
1102428273 12:112861711-112861733 GGAGTCATTAAGAATATCCCCGG + Intronic
1104629067 12:130384610-130384632 GGAAACATGCTGGGCATCCCAGG - Intergenic
1110416345 13:75257582-75257604 AGAGAGATTATGAGCATCCCAGG + Intergenic
1112296412 13:98191096-98191118 GGAGGCATTAAGGGAACTCCCGG + Intronic
1112567173 13:100561703-100561725 GGAGGTGTGAAGGGCATCCCGGG - Intronic
1113401597 13:109999325-109999347 GGAGACAGAAAATGCATCCCAGG + Intergenic
1113890928 13:113735295-113735317 GACGACATGAAGGGCATCTCCGG + Exonic
1122107374 14:99468715-99468737 GTAGACTTTAAGGGGATTCCTGG - Intronic
1122124250 14:99570621-99570643 GGAGACATAAAATGCATTCCAGG + Intronic
1123996237 15:25719700-25719722 GGGGACATGGAAGGCATCCCAGG - Intronic
1125753851 15:42049182-42049204 AGAGACATCAAGGGAAACCCTGG + Intronic
1125920808 15:43524564-43524586 GGAGACACTAAGCGCACACCAGG + Exonic
1130805152 15:87313291-87313313 GGAGAGGTAAAGGGCAACCCAGG + Intergenic
1131650170 15:94389337-94389359 GGACACACTGAGGGCAGCCCAGG + Intronic
1137751930 16:50869466-50869488 GGAGACTTCAAGGGAATACCGGG - Intergenic
1139508369 16:67411179-67411201 GGAGAGACTGCGGGCATCCCTGG + Intronic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1140506828 16:75478839-75478861 GGAGACGTTGAGCGCATTCCTGG + Exonic
1143521181 17:7445239-7445261 GGAGAGAATAAGTGCAGCCCTGG - Intronic
1144179478 17:12738309-12738331 GGAGAGATCATGGGCAGCCCTGG + Intronic
1144816186 17:18037169-18037191 AGAGAAAGGAAGGGCATCCCAGG - Intronic
1144932975 17:18874960-18874982 GTAGGCATTGAGGGCACCCCTGG + Intronic
1147922185 17:43924653-43924675 GGAGACATTAAGGGCTGAGCTGG + Intergenic
1149995956 17:61405972-61405994 GGTGTCCTAAAGGGCATCCCGGG - Intronic
1150163171 17:62916343-62916365 GCATACATTAAGGTCATCTCAGG - Intergenic
1150280931 17:63929327-63929349 GGAGACATTAAGTGGAACTCAGG + Intronic
1150808415 17:68337180-68337202 GGAAACACTGAGGGCAGCCCTGG + Intronic
1151751287 17:76039719-76039741 GGATACATCAAGGGCATCTTTGG - Exonic
1152610676 17:81313774-81313796 GAAGACATGAAGGGCCTGCCTGG - Exonic
1155282350 18:24252496-24252518 GGAGAAATAAAGGCCTTCCCAGG + Intronic
1157000022 18:43512600-43512622 GGACACATTCAGGCCATCCACGG + Intergenic
1157592002 18:48841722-48841744 GGAGACAGTGAGCGCTTCCCAGG - Intronic
1160070204 18:75621642-75621664 GGAGACACTGTGGGCTTCCCGGG - Intergenic
1161626913 19:5332497-5332519 GGAGCCATTCAGGGCTTCCTTGG + Intronic
1162619447 19:11829566-11829588 AGAGACATTAGGGACAGCCCAGG + Intronic
1162628177 19:11902870-11902892 AGAGACATTAGGGACAGCCCAGG + Intronic
1162632866 19:11942414-11942436 AGAGACATTAGGGACAGCCCAGG + Intronic
1162649283 19:12073749-12073771 ACAGACATTAAGAGCAGCCCAGG + Intronic
1163502124 19:17682476-17682498 GGTGCCAATAAGGGCATCCTGGG - Intronic
1163647376 19:18497328-18497350 GGAGACAGTAAGAGCATCGGTGG + Intronic
1166267753 19:41695609-41695631 AGAGACATAAAGGACATTCCAGG + Intronic
1166410979 19:42555275-42555297 AGAGACATAAAGGACATTCCAGG + Intronic
926956257 2:18304201-18304223 TGAGACATTATGGGAATCTCAGG + Intronic
929920965 2:46171290-46171312 GTAGACATTAGGGGCACCCCAGG - Intronic
931439277 2:62276540-62276562 GGAGACATTATGGCCATCTTTGG - Intergenic
936034596 2:109100762-109100784 GGAGACAATAAGGACTTCCAGGG + Intergenic
940090376 2:149909679-149909701 GGAGAAATTAAGCACATCCTGGG - Intergenic
941224289 2:162826989-162827011 GGGGACATTAAGGCTATCTCAGG + Intronic
942104489 2:172619281-172619303 GGAGAGAATGTGGGCATCCCTGG - Intergenic
944391479 2:199224261-199224283 GAAGAGATGGAGGGCATCCCTGG - Intergenic
1173988116 20:47278556-47278578 GGAGAAATAAAGCACATCCCTGG + Intronic
1174406581 20:50306856-50306878 GGGGACAGGAAGGGCATTCCTGG - Intergenic
1174632038 20:51966631-51966653 GGAGCCACTTAAGGCATCCCTGG + Intergenic
1176903020 21:14466607-14466629 TGAGAGATTAAGGCCTTCCCAGG + Intergenic
1181185152 22:21098010-21098032 GGAGACAATCAGGCCATACCTGG - Intergenic
1181433437 22:22896368-22896390 GGAGAAATGAAGGGGGTCCCCGG + Intergenic
1184190166 22:42889224-42889246 GGAGGGGTTATGGGCATCCCAGG + Intronic
951839426 3:27017899-27017921 GGAGACATTTAGGTCATAACTGG + Intergenic
952211277 3:31231437-31231459 GGAGGCATAAAGGACATCCAGGG + Intergenic
952265908 3:31786077-31786099 GGAGGGAATAATGGCATCCCTGG - Intronic
953931085 3:47006022-47006044 GAAGACATTGAGGGCCTCCTCGG - Exonic
954142018 3:48612603-48612625 CAAGACATTAAGGCCATGCCAGG - Intergenic
954357164 3:50091631-50091653 GGTGAAATTAAGTACATCCCTGG - Intronic
956319064 3:67975057-67975079 GAACACATCAAGGGCCTCCCTGG - Intergenic
958870246 3:99550174-99550196 GGAGACATTTAGAGCAAGCCAGG - Intergenic
961444180 3:126971365-126971387 GGTGACATTATGGGAGTCCCCGG + Intergenic
962132495 3:132696754-132696776 GGTGACATAAAGGGCATTGCAGG + Exonic
962828282 3:139118740-139118762 GGAGACATCTAGTGCAACCCAGG + Intronic
967876992 3:194274151-194274173 AGAGACATGAAGAGCATCCCAGG - Intergenic
969204184 4:5630232-5630254 TGAGACATCAGGGCCATCCCAGG - Intronic
972928630 4:44042599-44042621 GGAGAAATAAAGGCCTTCCCAGG + Intergenic
975681919 4:76885819-76885841 GGAGACACGAAGGCCATACCGGG - Intergenic
978869431 4:113557321-113557343 GGAGACATGAAGGTCATATCAGG - Intronic
979780013 4:124639052-124639074 GGAGACATGAAGGGCAGCAGGGG - Intergenic
984802799 4:183730163-183730185 GGAGACATTGCGGTGATCCCAGG + Intergenic
988245142 5:28670550-28670572 AGAGACATAAAGGAAATCCCTGG + Intergenic
988517946 5:31920801-31920823 GGAGACAGTAAGAAGATCCCTGG - Intronic
990343578 5:54849343-54849365 GGAGGCATTAAGTGCATCCTAGG + Intergenic
992982549 5:82191428-82191450 GCAGACCTTAAGGGCTTCCATGG - Intronic
994727703 5:103455854-103455876 GGAAAGATTAAGGGAATTCCTGG - Intergenic
1002904512 6:1438002-1438024 GGAGACCCGAAGGGCAGCCCCGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1006935195 6:37712316-37712338 GGAGACCCTAATGACATCCCAGG - Intergenic
1011670501 6:89678772-89678794 GGAGACAATAAGAAAATCCCAGG + Intronic
1014289516 6:119541613-119541635 GGAGAGTGTAAGGGAATCCCAGG - Intergenic
1014311648 6:119811141-119811163 GCAGAATTAAAGGGCATCCCAGG - Intergenic
1018356398 6:163021800-163021822 TGAGGCAGGAAGGGCATCCCAGG - Intronic
1022503274 7:30895749-30895771 GCAGACATCAAGGACTTCCCTGG - Intergenic
1022589737 7:31650311-31650333 GGGGAGGTTAAGGTCATCCCAGG + Intronic
1025275738 7:57580329-57580351 AGAGACATAAAGGGCAGGCCCGG - Intergenic
1027188296 7:75984423-75984445 GCCGACAGTAAGGGCAGCCCTGG - Intronic
1029711853 7:102304107-102304129 GGTATCATTCAGGGCATCCCAGG - Intronic
1032562807 7:132910162-132910184 GGATATATTAAGGGCGGCCCTGG + Intronic
1033235094 7:139631805-139631827 GGAGTCAGTAATGGCACCCCAGG - Intronic
1034409679 7:150933599-150933621 TGAGTCTTTAAGGGCATCCTGGG - Intergenic
1035415053 7:158676234-158676256 GGACACACTAATGGCATCACAGG + Intronic
1043126502 8:76403300-76403322 GGAGACATTATGGGATGCCCAGG - Intergenic
1047172064 8:122503273-122503295 ACAGACATTAAGGGCATGCAGGG + Intergenic
1047304424 8:123641492-123641514 GCAGACACTGAGGGCAGCCCTGG + Intergenic
1048295287 8:133209500-133209522 GGAACCATTTATGGCATCCCTGG - Intronic
1053133735 9:35636225-35636247 GGAAACATTTAGGGCATGTCTGG - Intronic
1053620045 9:39805801-39805823 GGAGACATTTTGGTCATTCCAGG + Intergenic
1053626652 9:39878141-39878163 GGAGACATTTTGGTCATTCCAGG - Intergenic
1053878217 9:42565103-42565125 GGAGACATTTTGGTCATTCCAGG + Intergenic
1053894441 9:42729263-42729285 GGAGACATTTTGGTCATTCCAGG - Intergenic
1054217235 9:62372562-62372584 GGAGACATTTTGGTCATTCCAGG + Intergenic
1054233476 9:62536591-62536613 GGAGACATTTTGGTCATTCCAGG - Intergenic
1054264111 9:62901643-62901665 GGAGACATTTTGGTCATTCCAGG - Intergenic
1057881722 9:98797014-98797036 AGCGACATTAAGGGCACCGCAGG - Intergenic
1057955850 9:99407232-99407254 ACAGACAATCAGGGCATCCCAGG - Intergenic
1060222016 9:121769260-121769282 GGAGGCATGAAGGGCCTTCCAGG - Intronic
1061183494 9:129038394-129038416 GGAGACCTTGAAGGCATCCTTGG + Intronic
1186902630 X:14074132-14074154 GAAGAAATTAAGGGCATCTTGGG - Intergenic
1190321103 X:49179659-49179681 GAAGACAGGAAGGGCATGCCAGG - Intronic
1193080654 X:77403079-77403101 GGAGAGAATAAGGAAATCCCAGG - Intergenic
1198506482 X:137306517-137306539 TGAGACATTAGGGCCTTCCCAGG + Intergenic
1198866624 X:141130015-141130037 GAAGACATTATTTGCATCCCTGG - Intergenic
1201292314 Y:12432970-12432992 GGAGGCAGTAAGGGCTGCCCAGG - Intergenic