ID: 1140057680

View in Genome Browser
Species Human (GRCh38)
Location 16:71539635-71539657
Sequence CAGTGTGAACAGAGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140057676_1140057680 12 Left 1140057676 16:71539600-71539622 CCCAGCATTGAAAATAAGACCAG 0: 1
1: 0
2: 2
3: 8
4: 225
Right 1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG 0: 1
1: 0
2: 8
3: 30
4: 368
1140057677_1140057680 11 Left 1140057677 16:71539601-71539623 CCAGCATTGAAAATAAGACCAGA 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG 0: 1
1: 0
2: 8
3: 30
4: 368
1140057678_1140057680 -7 Left 1140057678 16:71539619-71539641 CCAGAACAGCAGATGACAGTGTG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG 0: 1
1: 0
2: 8
3: 30
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140057680 Original CRISPR CAGTGTGAACAGAGTGAAGA GGG Intronic
900640128 1:3684551-3684573 CAGAACGAACAGAGTGAAGCGGG + Intronic
900760981 1:4470166-4470188 CATTTTGAGCTGAGTGAAGATGG + Intergenic
900821490 1:4892825-4892847 CAGGGTGAGAAGAGTGCAGAAGG - Intergenic
901622219 1:10597732-10597754 CTGTGTGAAGAGGGTAAAGAGGG + Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902383665 1:16064505-16064527 CAAAGTGGACAGAGTGGAGAGGG - Intronic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904975775 1:34455202-34455224 CAGTCGGAAATGAGTGAAGACGG + Intergenic
905059843 1:35130557-35130579 CAGTGTTAACAGGGTGTGGAAGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906280156 1:44547586-44547608 AAGTGTGCACCGAGAGAAGAGGG - Intronic
906943041 1:50272651-50272673 CAGTGTGAACAGTATAATGATGG + Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
907980330 1:59474063-59474085 CAGTTGGAACAGAGTGATGCAGG - Intronic
908529958 1:65025018-65025040 CAGTGAAAACAGAGCTAAGAGGG - Intergenic
908549098 1:65191569-65191591 CAATGTGAACAGGGTGAAAGGGG + Intronic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909950271 1:81711730-81711752 AAATGTCAACAGAGTGAAAAAGG + Intronic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
911286057 1:95994560-95994582 CAATGTCAACACAGTGAACAAGG + Intergenic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
911825450 1:102479343-102479365 CAGTGATAACAAAGTGATGATGG - Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
914883552 1:151566426-151566448 CACTGTTAACAGATTGAAGTGGG + Intronic
915382854 1:155458756-155458778 CAGTGTGGTCAGACTAAAGACGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915873103 1:159582985-159583007 GATTGTGAACAGCATGAAGATGG + Intergenic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921684753 1:218076991-218077013 CAGTGAGAACAGATATAAGAAGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922197973 1:223376183-223376205 CAGTGTAAACAGATTTAAGATGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
1064213916 10:13383690-13383712 CAGGGTGCTCCGAGTGAAGAGGG - Intergenic
1064747509 10:18492308-18492330 CACTGTAAACAAAGTGAATATGG + Intronic
1065092376 10:22247739-22247761 CAGTGTGAACTGAGTGAGCCAGG - Intergenic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1066707977 10:38202003-38202025 CAGAGTGAAGGCAGTGAAGAGGG + Intergenic
1068130948 10:52894424-52894446 AAGTGTGAACACAGTGAGGCTGG + Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1074100038 10:110347707-110347729 CACTTGGGACAGAGTGAAGAGGG - Intergenic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076869234 10:133185312-133185334 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869238 10:133185358-133185380 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869240 10:133185381-133185403 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077509728 11:2951790-2951812 CAGTTTGAAGAAGGTGAAGAAGG - Exonic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077895722 11:6451760-6451782 CAGAGTGAACAGATTGTAAAAGG + Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1080914167 11:36638226-36638248 CAATGTGAAAATACTGAAGAAGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1083962226 11:66020860-66020882 CAAGGTGAAGAGGGTGAAGATGG + Exonic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086875394 11:92089644-92089666 CAGTTTGAACATATTGCAGAGGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088845515 11:113662886-113662908 AAGTGTCAACATAGTGAAAAAGG + Intergenic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089096431 11:115923521-115923543 CACTTTGAACAGAGTAAGGAGGG + Intergenic
1090707478 11:129352146-129352168 AACTGGGAACAGAGTGAGGAAGG - Intergenic
1090898724 11:131005766-131005788 CAGTGTGAACAGAATCACGTAGG + Intergenic
1090936120 11:131344170-131344192 CAGTGCAAACAGAGAGAAAAGGG + Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1092679180 12:10958398-10958420 CTATGTGAACAGAGAGAAGGAGG + Intronic
1094042662 12:26133861-26133883 CAATGAGGACAGAGTGGAGAAGG + Intronic
1095267341 12:40175658-40175680 AAGAGTGAACAAAGTGAAGTGGG + Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1098101644 12:67024077-67024099 AAGTGTGAACAGTCTGAAAAGGG - Intergenic
1099146405 12:79050490-79050512 CAGTGTGATCAGAGTTTACAAGG - Intronic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1103645297 12:122387313-122387335 AAGTGTCAACATAGTGAAAAAGG - Intronic
1104860981 12:131923374-131923396 CAGGGTGAAGAGAGTCCAGAGGG + Intergenic
1105483493 13:20802356-20802378 AAGTGTGCAGACAGTGAAGAAGG - Intronic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106579190 13:31003139-31003161 CGGGGTGAACTGAGTGAAGCAGG - Intergenic
1107870700 13:44744076-44744098 CAGGCTGAATAGAGTGAATAAGG - Intergenic
1108439460 13:50435833-50435855 AAGCTTGATCAGAGTGAAGAAGG + Intronic
1109175538 13:59150828-59150850 CAGCATGAACAAAGTCAAGAAGG + Intergenic
1110653728 13:77972602-77972624 CAGTCTAAAGAGAGTCAAGAGGG + Intergenic
1111251044 13:85601756-85601778 CTGTGTGTACACTGTGAAGAGGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111820016 13:93201805-93201827 AATTATGAACAAAGTGAAGAGGG + Intergenic
1112225711 13:97537942-97537964 CAGTGTCAACAGCCTGAAGATGG + Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1117542289 14:56760002-56760024 CAGTGTCGACAGAGTGAAGGTGG + Intergenic
1117575440 14:57092635-57092657 CAGTGTGATCACTGTGGAGATGG + Intergenic
1117709929 14:58517164-58517186 CAGTGTTAAGAGAATGAAAAAGG + Intronic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118791172 14:69094347-69094369 TAGTGTGATCAGACTGCAGATGG - Intronic
1119054559 14:71406058-71406080 CAATGTGAAGACAGTGGAGATGG + Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122198771 14:100109227-100109249 CAGGGAGGACAGACTGAAGAAGG - Intronic
1123088927 14:105733183-105733205 CAGCGTGAACAGGGTGATGATGG - Intergenic
1124786507 15:32686388-32686410 GACTGTGAACACCGTGAAGAAGG + Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1131561159 15:93441370-93441392 CAGTGAGAACTGAGTGTATATGG + Intergenic
1131638069 15:94259101-94259123 CAGAGTGAACTGAGTGAGCATGG - Intronic
1131747836 15:95469007-95469029 CCGTGCGCACAGAGTGATGAGGG + Intergenic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135756005 16:25098693-25098715 CAATGTGAACGGACTCAAGATGG - Intergenic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137534013 16:49303689-49303711 AAGTAGGAACAGAGTAAAGAAGG + Intergenic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138463005 16:57164028-57164050 CAGTGTGAAAAGACTGAAACCGG - Exonic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140285106 16:73595563-73595585 GAGTGTGAATAGAGTCAAAATGG - Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141322784 16:83027412-83027434 AAGAGTTAACAGGGTGAAGAAGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142819146 17:2450445-2450467 GAGTGTGGACAGACTGCAGAGGG + Intronic
1145995895 17:29104770-29104792 GAGTGAGAACAGAGTCAAGGGGG + Intronic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150524006 17:65902545-65902567 TTGTGTCAACAGATTGAAGAAGG - Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1150944958 17:69734959-69734981 GATTGTGATCAGAGTTAAGAAGG - Intergenic
1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG + Intergenic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG + Intronic
1155411507 18:25550449-25550471 CAATGTGAAGAGAGTGAAAATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157404078 18:47409036-47409058 AAATGTCAACAGAGTAAAGAAGG - Intergenic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1159082840 18:63754754-63754776 CAGTGTGAAAACAGTGATGGTGG - Intronic
1159625870 18:70693291-70693313 AACTGGGAACAGACTGAAGAAGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1163203203 19:15782822-15782844 GAGGGTGAACAGGGTGATGATGG + Intergenic
1164310256 19:24039749-24039771 TAATGTGATCAGAATGAAGAAGG + Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166003020 19:39889532-39889554 CAGTGTGACCAGGGTGATCACGG - Exonic
1166005807 19:39905784-39905806 CAGTGTGACCAGGGTGATCACGG - Exonic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1167669925 19:50844888-50844910 AAGTGTGAAAAGTGTGAAGGGGG - Intergenic
925151549 2:1618705-1618727 CAGTGGGAACAGACTGAACCAGG - Intergenic
926512135 2:13795006-13795028 AAGTCTCAACATAGTGAAGATGG - Intergenic
927375309 2:22406346-22406368 CAGTGGGAAATGACTGAAGAAGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
927727351 2:25436445-25436467 AAGAGTGTACAGAGTGAAGCAGG - Intronic
927807761 2:26162995-26163017 TAGTGTGCACAAAGTTAAGAGGG - Intergenic
928017882 2:27675629-27675651 GCGTCTGAACAGAATGAAGAAGG + Exonic
928226670 2:29455215-29455237 CAGTGTGAAGAGAGCCCAGAGGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932417513 2:71582577-71582599 TATAGTGAAGAGAGTGAAGATGG + Intronic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933486374 2:82929839-82929861 CAGTGTGAATAGTGTAATGAGGG + Intergenic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
936717352 2:115203464-115203486 CAGCATGAACAGATTGGAGAGGG + Intronic
936895482 2:117422911-117422933 CACTGAGAACAAAGTGAGGAAGG + Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
940495408 2:154422005-154422027 CAGCGTGCACAGAGAGCAGAGGG + Intronic
940962000 2:159796987-159797009 CAGTCTGAACAATGTGAACATGG + Intronic
940971232 2:159899153-159899175 GAGTGGGAACAGACTGAGGATGG - Intronic
940998912 2:160180638-160180660 AAATGTCAACACAGTGAAGAAGG - Intronic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943258480 2:185628441-185628463 CAGTGTGTACAGAGATAACATGG - Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
944199885 2:197095305-197095327 CAGTGAGAAAAGAATAAAGATGG + Intronic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945547381 2:211173322-211173344 CAGGGAGTACAAAGTGAAGAGGG - Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946940729 2:224767696-224767718 CAATGTGTACTGAGTTAAGATGG + Intronic
946963121 2:225006017-225006039 TAGAGTGGAAAGAGTGAAGATGG + Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947794612 2:232886331-232886353 CAGTGTGTACTGTGTGATGAGGG + Intronic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169705216 20:8495874-8495896 TACTTTGAATAGAGTGAAGAAGG - Intronic
1170804018 20:19614058-19614080 CAGTTTCAACAGTGTGATGAGGG + Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1174193416 20:48756273-48756295 AGGTGGGAACAGAGTGGAGAGGG - Intronic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175459810 20:59144005-59144027 CTGTGTGAACAGAGTTAAATGGG - Intergenic
1176588750 21:8619164-8619186 CAGTGTGTACACAGTCAAGTAGG - Intergenic
1177252516 21:18612827-18612849 CTATGTGAGCAGAGTCAAGATGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177729837 21:25014647-25014669 AAGTGTGAAGAAATTGAAGAGGG - Intergenic
1180271576 22:10596160-10596182 CAGTGTGTACACAGTCAAGTAGG - Intergenic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181983043 22:26779842-26779864 CAGAGAGAACAGAGTGCACAAGG - Intergenic
1183050070 22:35253742-35253764 CTGAGAGAACAGAGTTAAGAGGG + Intergenic
1183719271 22:39552897-39552919 CAGAGAGAAAAGAGTGGAGAGGG - Intergenic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184257202 22:43294158-43294180 CAGTGGGAAAAGGGTGCAGAGGG - Intronic
1184760760 22:46542774-46542796 CAGAGTGCACAGCGTGGAGATGG + Intergenic
949992227 3:9588927-9588949 CACTGTTAATAGAGTGAAAAGGG - Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
954411656 3:50373824-50373846 AAGTGGGAACTGAGTGAGGATGG + Intronic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
955685273 3:61543139-61543161 CATTGTGAACAGAGTGTACAAGG - Intergenic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956665821 3:71641218-71641240 CAATGTGAACAATGTGCAGAGGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
963291057 3:143489716-143489738 CAGTGTAAACAGAGTAAAAAAGG + Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
963993379 3:151679278-151679300 CAGCATCAACAGAGTTAAGAGGG + Intergenic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
966135692 3:176695714-176695736 TAGTGTGGACAGAGACAAGACGG + Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970099661 4:12505616-12505638 GAGTGAGAAAAGAGTGAAGGAGG - Intergenic
971081014 4:23211239-23211261 CAGTGTTCACACAGTGATGAAGG - Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971363500 4:25957784-25957806 CAGTGTCTACTGAGTGAATATGG - Intergenic
973072987 4:45888434-45888456 CAGTGGGAGCAGTGTTAAGAGGG - Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975804696 4:78099667-78099689 CAGTGAGAACATAGTAAAGTGGG + Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
980474565 4:133295937-133295959 GAGTGTTAACAGTGTGAACAAGG + Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
980973925 4:139592748-139592770 CAGAGAGAACAGTGTGAAAAAGG + Intronic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
982197135 4:152927943-152927965 CAGTGTGAAAAGACTGAAACCGG + Intergenic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985171437 4:187154189-187154211 AAGTGTGAGGAGAGTGAAGGAGG + Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
985839763 5:2297719-2297741 CACTGATTACAGAGTGAAGATGG - Intergenic
986979111 5:13426443-13426465 AAGTGTCAACAGAGTGAAAAGGG - Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
988282889 5:29173101-29173123 GAATGAGAACTGAGTGAAGAAGG + Intergenic
988925608 5:35988663-35988685 AAATGTGAACAGTGAGAAGATGG + Intronic
989144345 5:38234045-38234067 GAATGAGAACAGAGTGAAGGGGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
991534239 5:67648991-67649013 CAATGACAACAGAGTGAAGAGGG - Intergenic
991540419 5:67721419-67721441 TAGTTTGAACACAGTGGAGATGG - Intergenic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995565599 5:113430787-113430809 CAGCGTGAAGAGACTGCAGATGG + Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997285680 5:132676503-132676525 GAGTGAGGACTGAGTGAAGAGGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
998914657 5:147000834-147000856 CAGTGTGAACCTAGTCAGGAGGG - Intronic
999596571 5:153211612-153211634 GAGTGTGAACTAAGTGAAAAAGG + Intergenic
1000513855 5:162216285-162216307 TAGTGTAAAGAGGGTGAAGAGGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1005594441 6:27365879-27365901 CAATGTGAATAGAGCAAAGAAGG + Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006825876 6:36936095-36936117 CAGTTACAACAGAGTAAAGATGG - Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1011169333 6:84488734-84488756 AATTGAGAACAGAGTGAAGGGGG + Intergenic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012601454 6:101102590-101102612 GGGTGGGAACAGAGTGAAGCTGG - Intergenic
1014520460 6:122436148-122436170 CAGTGTGAAGACAGTGTAGGGGG + Intergenic
1016276542 6:142359803-142359825 AAGTGTGAACAGAGCTAATAAGG + Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1021402774 7:20228726-20228748 CTGTGTGAACATAGTCATGAAGG - Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1026105482 7:67417559-67417581 CTGTGTGGACATAGTGAAAATGG + Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1028156153 7:87431850-87431872 AAGTGTGAAAACACTGAAGAAGG - Intronic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029238142 7:99140714-99140736 CAGTGCAAAGATAGTGAAGATGG - Intronic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1033246345 7:139719435-139719457 CAGAGAGAACAGAGTCAAAACGG - Intronic
1033571358 7:142631964-142631986 CAGTGTGAACAGAGTTGATGCGG + Intergenic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035231836 7:157470031-157470053 CAGTGTGAAGAGAGTGACCTGGG - Intergenic
1035696827 8:1604110-1604132 CAGTGTCCACAAAATGAAGAAGG - Intronic
1037482815 8:19320695-19320717 TAGTGAGAACGGAGTGAGGAGGG - Intronic
1038213476 8:25540866-25540888 ATCTGTGAAAAGAGTGAAGAGGG - Intergenic
1038546212 8:28427504-28427526 CAGAGTTAAGAGGGTGAAGAAGG - Intronic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039016005 8:33149505-33149527 AAGTGTAACCAGATTGAAGATGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039577175 8:38632910-38632932 CTGAGTGAACAGAATGGAGAAGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1042515872 8:69658484-69658506 CTCTGTGAAAAGAGAGAAGAAGG - Exonic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048612045 8:136033589-136033611 CAGGGTGAAAAGAGTCAAGCAGG - Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049963174 9:755745-755767 CAGTGGGAACAGGCTGGAGATGG - Intergenic
1050552984 9:6763630-6763652 CAGTGTTACCATTGTGAAGAGGG + Intronic
1051599474 9:18858376-18858398 GAGGCTGAACAGAGTGAAAAGGG - Intronic
1052477862 9:28984076-28984098 AAATGAGAAGAGAGTGAAGAAGG - Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1055136522 9:72835274-72835296 TGGGATGAACAGAGTGAAGATGG - Intronic
1055774028 9:79748585-79748607 GAGAGTGAACAGAGAGAATAAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056891587 9:90499134-90499156 GAGTGAGGACAGACTGAAGACGG - Intergenic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1059181604 9:112219007-112219029 CAGTGTGAACAGAATGGATTAGG - Exonic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059894881 9:118851784-118851806 CAATGTGAACACAATGATGAAGG + Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060619382 9:125049821-125049843 CATTATGAGCAGAGTGAAAAAGG - Intronic
1060622538 9:125081130-125081152 CTTTGTGAGCAGAGTGAAAATGG + Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061946528 9:133911525-133911547 CACTGTCAACACAGTCAAGACGG + Intronic
1062277974 9:135739574-135739596 CGGTGTGAACACCATGAAGAGGG - Intronic
1186217732 X:7317822-7317844 CAGAGAGAACACAGTGAAGAGGG - Intronic
1187277854 X:17832170-17832192 CACTGATAACAGAGTGAAAAGGG + Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1192508821 X:71709572-71709594 CAGTTTGAAAACAGTGAAAAAGG + Intergenic
1192517876 X:71771981-71772003 CAGTTTGAAAACAGTGAAAAAGG - Intergenic
1194287493 X:92028391-92028413 CAGTGTAGAAATAGTGAAGAAGG - Intronic
1194573546 X:95582598-95582620 CAGAGTGAAAAGACTTAAGATGG - Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195146464 X:102022234-102022256 CAGGAAGAAGAGAGTGAAGAGGG - Intergenic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1196154818 X:112417211-112417233 AAGTGGGCACAGATTGAAGATGG + Intergenic
1197712311 X:129680155-129680177 CAGAGTGAACAGATTGGAGGGGG + Intergenic
1197721058 X:129744957-129744979 CAGTGTGAACAGTGTGGGGGCGG + Intronic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1198847551 X:140928956-140928978 CAGTTTGTACTGAGTGAAGATGG - Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1200605032 Y:5252958-5252980 CAGTGTAGAAATAGTGAAGAAGG - Intronic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1202027743 Y:20542323-20542345 TAGGCTGAACAGAGTCAAGATGG - Intergenic