ID: 1140058614

View in Genome Browser
Species Human (GRCh38)
Location 16:71547648-71547670
Sequence ACCACATACACACCTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140058612_1140058614 7 Left 1140058612 16:71547618-71547640 CCCATCTCATATTTGTAGATCTA 0: 1
1: 0
2: 3
3: 19
4: 317
Right 1140058614 16:71547648-71547670 ACCACATACACACCTTCCTCTGG 0: 1
1: 0
2: 1
3: 20
4: 204
1140058613_1140058614 6 Left 1140058613 16:71547619-71547641 CCATCTCATATTTGTAGATCTAT 0: 1
1: 0
2: 2
3: 30
4: 316
Right 1140058614 16:71547648-71547670 ACCACATACACACCTTCCTCTGG 0: 1
1: 0
2: 1
3: 20
4: 204
1140058611_1140058614 29 Left 1140058611 16:71547596-71547618 CCTTCTTGGACTCTACTTTCTAC 0: 1
1: 1
2: 2
3: 26
4: 285
Right 1140058614 16:71547648-71547670 ACCACATACACACCTTCCTCTGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140058614 Original CRISPR ACCACATACACACCTTCCTC TGG Intronic