ID: 1140058614 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:71547648-71547670 |
Sequence | ACCACATACACACCTTCCTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 226 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 20, 4: 204} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1140058612_1140058614 | 7 | Left | 1140058612 | 16:71547618-71547640 | CCCATCTCATATTTGTAGATCTA | 0: 1 1: 0 2: 3 3: 19 4: 317 |
||
Right | 1140058614 | 16:71547648-71547670 | ACCACATACACACCTTCCTCTGG | 0: 1 1: 0 2: 1 3: 20 4: 204 |
||||
1140058613_1140058614 | 6 | Left | 1140058613 | 16:71547619-71547641 | CCATCTCATATTTGTAGATCTAT | 0: 1 1: 0 2: 2 3: 30 4: 316 |
||
Right | 1140058614 | 16:71547648-71547670 | ACCACATACACACCTTCCTCTGG | 0: 1 1: 0 2: 1 3: 20 4: 204 |
||||
1140058611_1140058614 | 29 | Left | 1140058611 | 16:71547596-71547618 | CCTTCTTGGACTCTACTTTCTAC | 0: 1 1: 1 2: 2 3: 26 4: 285 |
||
Right | 1140058614 | 16:71547648-71547670 | ACCACATACACACCTTCCTCTGG | 0: 1 1: 0 2: 1 3: 20 4: 204 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1140058614 | Original CRISPR | ACCACATACACACCTTCCTC TGG | Intronic | ||