ID: 1140070945

View in Genome Browser
Species Human (GRCh38)
Location 16:71649152-71649174
Sequence CCATAGAGGCAGGAGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 471}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140070935_1140070945 15 Left 1140070935 16:71649114-71649136 CCTCTAGGGGCACAATAGAGCCA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 471
1140070937_1140070945 -5 Left 1140070937 16:71649134-71649156 CCATTGGAGAGTTTCTTCCCATA 0: 1
1: 0
2: 0
3: 14
4: 181
Right 1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG 0: 1
1: 0
2: 3
3: 48
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140070945 Original CRISPR CCATAGAGGCAGGAGGTGGA GGG Exonic
900548210 1:3240558-3240580 CCATACCAGCGGGAGGTGGACGG - Intronic
900809029 1:4787218-4787240 CTACAGTGGGAGGAGGTGGATGG + Exonic
901001710 1:6152078-6152100 CCATTTGGGCAGGAGGTGGAGGG - Intronic
901228245 1:7627063-7627085 CCAATGTGGCAGGATGTGGATGG + Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903007774 1:20309835-20309857 CCATGAAGGGAGGATGTGGACGG + Intronic
903460301 1:23516299-23516321 CCAGAGGGACAGGAGGTGGGGGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
905341390 1:37280409-37280431 CCCTAGAGGAAGGAGAAGGAAGG - Intergenic
905785111 1:40749255-40749277 CCATAGAGCCAGTAAGTGGCAGG - Intronic
905892478 1:41526046-41526068 ACAGAGGGGCAGGAGGTGGCTGG + Intronic
906501241 1:46342879-46342901 CCAGAGAGGCAGGAGGGAGGTGG - Intronic
906925278 1:50109426-50109448 ACATAAAGGCAAGGGGTGGAGGG + Intronic
907258142 1:53196001-53196023 TCTTAGAGTCAGGAGTTGGAAGG + Intergenic
907726778 1:57027385-57027407 GCAAAGAGGCAGGGGCTGGATGG - Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907908682 1:58808423-58808445 CCAAAGAGGCAGGGGAAGGAGGG + Intergenic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
909021609 1:70437539-70437561 CCACATAGGCAGTATGTGGAAGG + Intronic
909546691 1:76855936-76855958 ACATAGAGGGAGGAGGTGTAAGG + Intergenic
910111969 1:83692755-83692777 CCTTAAGGGTAGGAGGTGGAAGG - Intergenic
910208943 1:84774749-84774771 CCAGAGAGGCCGGCTGTGGAGGG + Intergenic
911643424 1:100313380-100313402 GCAAAGAGGCAGGTGCTGGAGGG + Intergenic
912234149 1:107830595-107830617 GCAAAGAGGCAGGGGCTGGAGGG - Intronic
912370102 1:109167259-109167281 TCAGAGAGGCAGGATGTGGGTGG + Intronic
913500871 1:119471609-119471631 CCACAGAGGCAAGGGGTGGCTGG - Intergenic
916190086 1:162169941-162169963 CCATACAGGCAGGAAAGGGAGGG - Intronic
916850705 1:168700518-168700540 ATATAGAGGCACGGGGTGGAAGG + Intronic
916865276 1:168849850-168849872 CCAAAAAGGCAGGAAATGGATGG - Intergenic
917517778 1:175722212-175722234 CGATAGGGGAAGGAGGAGGAGGG - Intronic
917571055 1:176265878-176265900 GCAAAGAGGCAGGAGCTGGAGGG + Intergenic
917854140 1:179087849-179087871 CCCTCAAGGCCGGAGGTGGAAGG + Intronic
918565520 1:185925884-185925906 CCATTGAGCCAGGAGGAGAAGGG + Intronic
918734030 1:188036661-188036683 CCATAGTGGAAGAAGGTGAAAGG - Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920181393 1:204134201-204134223 CCACAGAGCCTGGTGGTGGATGG - Intronic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
921678686 1:218006320-218006342 CCAAAAAGGCAGGGGATGGAGGG + Intergenic
922507166 1:226133300-226133322 CCAGGAAGGGAGGAGGTGGAGGG - Intergenic
922738098 1:228000436-228000458 GCATGGAGCTAGGAGGTGGATGG + Intergenic
923619657 1:235568066-235568088 CCAAAAAGGCAGGGGCTGGAAGG - Intronic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
924169647 1:241325108-241325130 CCTTAGAGTCAGGTCGTGGATGG - Intronic
924322742 1:242865900-242865922 ACATAGAGGCAGGAGGGGCGAGG - Intergenic
1062923564 10:1297807-1297829 CCATGGAGGCAGGGGCTGGAGGG + Intronic
1063150683 10:3333615-3333637 CCTGAGAGGCAGGAGCTGGTGGG + Intergenic
1064332034 10:14403014-14403036 CCAAAGAGTCAAGAGGAGGATGG - Intronic
1064589090 10:16869809-16869831 TCATGGGAGCAGGAGGTGGAGGG + Exonic
1065480724 10:26191374-26191396 GAATAGATGGAGGAGGTGGAGGG - Intronic
1065841549 10:29705428-29705450 CCATACAGAAAGGAGGCGGAGGG + Intronic
1066209171 10:33220034-33220056 CCTTAGAGGCAGGAATTGGGTGG - Intronic
1067901263 10:50244087-50244109 GCAAAGAAGCAGGAGCTGGAGGG + Intronic
1068088228 10:52401064-52401086 GTATAGAGGCAGGAGGTGACAGG - Intergenic
1068896977 10:62215364-62215386 AAATAAAGGCAGGAGGTGAAGGG + Intronic
1069071272 10:63992572-63992594 CCATGGAGGCAGATGGTTGAGGG + Intergenic
1069536794 10:69259693-69259715 CCATAATGGCAGAAGGTGAAGGG + Intronic
1069725302 10:70573718-70573740 ACGTAGAGGCAAGAGGGGGAAGG - Intergenic
1069815640 10:71191970-71191992 CCAGAGAGGCAGGAGGAGAGGGG + Intergenic
1070122295 10:73589841-73589863 CTGTAGGGGCAGGAGGTGAAGGG + Intronic
1070264944 10:74893080-74893102 CCACAGAGGCAGGAGCTGAGAGG + Intronic
1070389708 10:75958831-75958853 CAATCGTGGCAGAAGGTGGAAGG + Intronic
1070518559 10:77230725-77230747 CCAAAGAGGCAGGAACTGGGAGG - Intronic
1071515633 10:86294911-86294933 CCACAGAGCCAGGAGGAGGGAGG + Intronic
1071826794 10:89333497-89333519 CCCAAGAGGCAGGAGGGGGGAGG + Intronic
1074237280 10:111598376-111598398 CCAAAGAGCCAGCAGCTGGAAGG + Intergenic
1074856352 10:117476907-117476929 GCAGAGAGACAGGAAGTGGAGGG - Intergenic
1074870676 10:117573612-117573634 ACATGGAGGAAGGAGGTGGGTGG - Intergenic
1076068092 10:127464700-127464722 TCATAGGAGCAGGAGGAGGATGG + Intergenic
1076574224 10:131453357-131453379 GCAGAGAGGCGGGAGGTGGATGG + Intergenic
1077141297 11:1026073-1026095 CCGTAGAGGGTGCAGGTGGATGG + Exonic
1077388811 11:2289737-2289759 CCATAGAGACAGAAAGTGGATGG + Intergenic
1078320731 11:10332385-10332407 ACATGGTGGCAGGAGATGGAGGG + Intronic
1081669386 11:44934747-44934769 CCAGGGAGGCAGGGGGTGGGGGG - Exonic
1081928910 11:46854280-46854302 CCAAAGAGGAAGGAGGGAGAAGG + Intergenic
1082255155 11:50026225-50026247 CAATAGTGGCAGAAGGTGAAGGG - Intergenic
1082830941 11:57616714-57616736 CAACAAAGTCAGGAGGTGGAAGG + Intergenic
1083088047 11:60170297-60170319 ACATAGAGGGTGGAAGTGGAAGG + Intergenic
1083935951 11:65870242-65870264 GGATAGAGGCAGGAGAAGGAGGG + Intronic
1084048248 11:66583379-66583401 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1084789609 11:71465124-71465146 GCAGAGAGGCAGGGGCTGGAGGG + Intronic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1085663628 11:78393053-78393075 GCAGAGAGGCAGGATGTTGAGGG + Intronic
1088099661 11:106141963-106141985 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1088653682 11:111979042-111979064 CCAAACAGGCAGGAGGGGTAGGG - Intronic
1088745200 11:112799124-112799146 CCACAGAGTTAGGAGGTGGTGGG - Intergenic
1089359074 11:117874556-117874578 CCAGGGAGGCAGGAAGGGGAGGG - Intronic
1089780015 11:120867101-120867123 CCACAGAGACAGTAGCTGGAAGG - Intronic
1090077224 11:123587102-123587124 GCAGAGAGGCAGCAGGTGAAGGG - Intronic
1090267442 11:125362162-125362184 AAAAAGAGGCAGGAGGTGTAGGG - Intronic
1090331567 11:125936391-125936413 CCACAGAGACAGAAGGTAGAAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1090703558 11:129316582-129316604 CAAGAGAGGGAGGAGGTGAAGGG - Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091385904 12:94497-94519 CCCAAGGAGCAGGAGGTGGATGG + Intronic
1091604142 12:1935962-1935984 CGAAAGAGACAGGAGGTGGTGGG + Intergenic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1096869849 12:54586486-54586508 ACAGAGTGGCAGGCGGTGGAGGG - Intronic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1099460162 12:82911347-82911369 ACACAGAGGCTGGAGGTGGGCGG - Intronic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1101619785 12:106374323-106374345 CCAGGGAGGCTGGAGGTGGGAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101906626 12:108831568-108831590 CCACGGTGGAAGGAGGTGGAAGG + Intronic
1102518365 12:113464792-113464814 CCATAAATTCAGGAGGTGTAGGG + Intronic
1102522431 12:113486920-113486942 CCACAGAGGCAGCAGGTGTAGGG - Intergenic
1102907618 12:116688844-116688866 CCACAGAAGCAGGCGGTGGTGGG + Intergenic
1103085759 12:118061028-118061050 CCATGGAGGCCGGAGGTGAGTGG - Intronic
1103524646 12:121559554-121559576 CCAGGGAGGCAGGAGATGTAGGG + Intronic
1103932762 12:124459329-124459351 CCAGAGAGACAGGAGGAGGTGGG - Intronic
1104234359 12:126918640-126918662 CCATAGAGGCAGAATGCAGATGG - Intergenic
1104285592 12:127421637-127421659 CTATAGAGGCAGGAGCTCGGAGG - Intergenic
1104480876 12:129106931-129106953 CAATAGAGGCATGTTGTGGAAGG + Intronic
1104684966 12:130778893-130778915 CCATCTAGACAGGAGGTGGCGGG - Intergenic
1104787782 12:131460807-131460829 TCATAAAGGCAGGAAGGGGAGGG + Intergenic
1104901358 12:132191025-132191047 CCAGCGAGGGAGGAGGTGGGAGG + Intergenic
1104964356 12:132502349-132502371 CCATAAGGGCCGGGGGTGGAGGG - Intronic
1105015585 12:132784954-132784976 CCATCGAGGCAGCAAGTGGGCGG - Intronic
1105820217 13:24074203-24074225 TCATAGAGACAGGAAGTAGAAGG - Intronic
1106212980 13:27668078-27668100 CCACAGAAACAGGAGGTGGCTGG - Intergenic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1107072495 13:36286333-36286355 CAAAAGAGGCAGAAGGTGGTTGG - Intronic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1108726883 13:53192591-53192613 CCAAAGAGTCAGGAATTGGAAGG - Intergenic
1110439967 13:75516880-75516902 CCATAGTGGCAGAAGGTGGAAGG - Intergenic
1110746985 13:79065464-79065486 CCTTGGAGGCAGGAGATGGCAGG - Intergenic
1110939068 13:81326851-81326873 CCATGGAGGCAAGAGGTGAGTGG - Intergenic
1112095331 13:96126541-96126563 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1112374690 13:98828064-98828086 CCACGGAGGCAGGAACTGGAGGG + Intronic
1114272119 14:21107223-21107245 ACAATGAGGCAGGAGGCGGAGGG + Intergenic
1114557401 14:23569928-23569950 GACTAGAGGGAGGAGGTGGAAGG - Intronic
1116846815 14:49872363-49872385 CCTTGGAGGCTGGAGGTGGGAGG - Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117190671 14:53287817-53287839 TCATAGAGGCAGAAAGTAGAAGG - Intergenic
1117663139 14:58029131-58029153 CCATAGAGACAGAAAGTGAATGG - Intronic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118753118 14:68820731-68820753 CCATAGCGACAGGAAGTAGAGGG - Intergenic
1120970348 14:90201882-90201904 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1121428129 14:93867872-93867894 TCATAGAGGGAGTAGGTGGGTGG - Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122785537 14:104161741-104161763 CTATAGAAGCAGGAGGCGCAGGG + Intronic
1122843064 14:104476107-104476129 ACACAGAGGCTGGAGCTGGAGGG - Intronic
1122920588 14:104878329-104878351 CCATCGAGGCAGGCAGAGGAGGG - Intronic
1123467408 15:20527143-20527165 CCATAGGGGCAGCAGGAGGTAGG + Intergenic
1123650706 15:22473899-22473921 CCATAGGGGCAGCAGGAGGTAGG - Intergenic
1123741115 15:23282741-23282763 CCATAGGGGCAGCAGGAGGTAGG - Intergenic
1123745883 15:23319817-23319839 CCATAGGGGCAGCAGGAGGTAGG + Intergenic
1124142046 15:27086224-27086246 CCCTAGGAGCAGGAGGAGGAAGG + Intronic
1124278155 15:28343134-28343156 CCATAGGGGCAGCAGGAGGTAGG + Intergenic
1124304546 15:28568474-28568496 CCATAGGGGCAGCAGGAGGTAGG - Intergenic
1124926852 15:34078363-34078385 CAATAGAGGTAGGAGGAGGGTGG + Intergenic
1125234533 15:37497667-37497689 CCCCAGAGGAAGGAGGGGGAAGG + Intergenic
1125461779 15:39914263-39914285 CTAAGGAGGCAGGAGGTGGTAGG - Intronic
1125931342 15:43602261-43602283 CCATGAGTGCAGGAGGTGGAGGG - Intronic
1126123822 15:45277617-45277639 CCATAGAGACAGAAGGGAGATGG + Exonic
1126387902 15:48112745-48112767 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128332690 15:66766181-66766203 CCATAGGGAAGGGAGGTGGAAGG + Intronic
1129037955 15:72662320-72662342 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129211934 15:74074911-74074933 CACCTGAGGCAGGAGGTGGAAGG - Exonic
1129289316 15:74551557-74551579 CCAAAGAGTCAGGAAATGGAGGG - Intronic
1129398469 15:75266173-75266195 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129402077 15:75290449-75290471 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129729060 15:77919225-77919247 CACCTGAGGCAGGAGGTGGAAGG - Intergenic
1132104283 15:99051493-99051515 GCAGAGAGGCAGGTGTTGGAGGG - Intergenic
1132662669 16:1068603-1068625 CCATAGCGGGGGGAGGAGGAAGG - Intergenic
1133985125 16:10662551-10662573 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
1134160134 16:11881183-11881205 ACATAGAGGCAGCTGGTGGGTGG - Intronic
1134389815 16:13808931-13808953 CAATAGAGACAGGATGTGAAGGG + Intergenic
1134635426 16:15788162-15788184 ACATAGAGGCAGTATCTGGATGG - Intronic
1135258133 16:20958019-20958041 GGATAGAGGCAGGAGGCGGGAGG + Intronic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1137056245 16:35747931-35747953 CCAGAGAGTCAGGGGGTGGTTGG - Intergenic
1137057779 16:35753728-35753750 CCAGAGAGTCAGGGGGTGGTTGG - Intergenic
1137057859 16:35753982-35754004 CCAGAGAGTCCGGAGGTGGTTGG - Intergenic
1137578391 16:49618963-49618985 ACTTTGAGGCAGGAGGTGGGTGG - Intronic
1138008105 16:53355844-53355866 CGATAGGGGCAGGAGGAGGTAGG + Intergenic
1138330988 16:56215068-56215090 GTATGGAGGCAGGAGGTGGTGGG - Intronic
1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG + Intronic
1139136478 16:64210867-64210889 CAATAGAGGCAGAAGGTCAATGG + Intergenic
1139354553 16:66359864-66359886 CCAGACAGGCAGGAGGCAGATGG + Intergenic
1139404363 16:66706573-66706595 CCATGGAGAGAGAAGGTGGAGGG - Intergenic
1139693704 16:68657615-68657637 CCACAGAGCTAGGAGGTGGGAGG + Intronic
1139827342 16:69767629-69767651 GCAAAGAGGCAGGAGATGGAGGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140256081 16:73337411-73337433 CCATAGTGCCAGGAAGTGGGTGG + Intergenic
1140383363 16:74511010-74511032 CCATGGAAGCAAGGGGTGGAGGG + Intronic
1140874090 16:79134404-79134426 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1141390820 16:83661919-83661941 CTGTAGAGCCAGGAGGTTGAGGG + Intronic
1141610261 16:85177164-85177186 CCCTGGAAGCAGGAGGGGGAAGG + Intronic
1141735493 16:85849606-85849628 CAGTAGAGGCAAGAGGTGCAGGG - Intergenic
1141757066 16:85998385-85998407 GCATTGAGCCAGAAGGTGGAGGG - Intergenic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1142880723 17:2880664-2880686 CCATAGAGACAGAAAGTAGATGG - Intronic
1143462503 17:7112827-7112849 CCATGGAGGCAGGAGGAGCAGGG - Intronic
1144423988 17:15123912-15123934 CCATAGAGGCAGGAATTGTGGGG - Intergenic
1144772045 17:17765325-17765347 CAGTCCAGGCAGGAGGTGGAGGG + Intronic
1146906621 17:36622196-36622218 CCATAGGGACAGGAGGGGGCAGG - Intergenic
1147042789 17:37731177-37731199 CCAGAGATGGAGGAGGTGGCCGG + Intronic
1147214712 17:38892475-38892497 CCATGGGGGCCAGAGGTGGAGGG + Intronic
1147955789 17:44133657-44133679 CCAGGAAGGCAGGAGGTGGGAGG - Intergenic
1148126652 17:45240920-45240942 CCAGTGATGCGGGAGGTGGAGGG - Intronic
1148678175 17:49457169-49457191 CCACAGAGACTGGATGTGGAGGG - Intronic
1148992094 17:51675136-51675158 CCATGGAGGCAGCCGGAGGAGGG + Intronic
1149867287 17:60157864-60157886 CCAGCGAGGCAGGAGGGGGCGGG + Intronic
1150182405 17:63138152-63138174 CCAGAGACGCAGGGGGTGGGAGG - Intronic
1151240269 17:72751972-72751994 GCACAGAGGCAGGAAGTAGAAGG - Intronic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1152191181 17:78888754-78888776 CCAAGGAGGCAGCAGGGGGATGG + Intronic
1153743962 18:8157981-8158003 CCACAGTTGCAGGAGGTCGAAGG + Intronic
1153866512 18:9274537-9274559 GCATAGAGGAAGGGGGTGGAGGG + Intronic
1154111126 18:11569380-11569402 CCAAAGATGCTGGAGATGGAAGG - Intergenic
1155161486 18:23199642-23199664 CCATAGAGACAGAAGGTGGTAGG + Intronic
1155517384 18:26637214-26637236 CGATAGAGTCAGGAGGAGGAAGG - Intronic
1155991166 18:32280870-32280892 CCAAAGAGTCAGAAGGTGGGTGG - Intronic
1158251339 18:55491149-55491171 GCATAGAGGCATGTGGTGAAGGG - Intronic
1159948503 18:74461247-74461269 TCCTACAGGCAGGAGTTGGAGGG - Intergenic
1160006858 18:75074516-75074538 AAATAGTGGCAGGAAGTGGAAGG - Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1160875611 19:1295072-1295094 ACACTGAGGCAGGAGGTGGGGGG + Intronic
1162055655 19:8062374-8062396 CCAGACGGGCAGGAGGTGGTGGG - Exonic
1162790067 19:13058124-13058146 CCAGAGAAGCAGGAGCTGGGAGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163425022 19:17236279-17236301 CCATAGAGACATGGGGTGGGGGG + Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1164837988 19:31370537-31370559 CCCTAGGGGCTGGAGGTTGAAGG - Intergenic
1165164244 19:33840338-33840360 CAGTAAAGGCAGGAGGTGAAAGG + Intergenic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
1166404634 19:42511280-42511302 TAATAGAGGCAGGAGGCGGAAGG + Intronic
1167006963 19:46782524-46782546 CCCGTGGGGCAGGAGGTGGAGGG - Exonic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
1168289470 19:55350506-55350528 CCATACAGACAGGAGCTGGCTGG + Exonic
1168429617 19:56267937-56267959 GCACACAGCCAGGAGGTGGAGGG + Intronic
1168444708 19:56402047-56402069 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
925340697 2:3133554-3133576 TCATAGAGACAGAAAGTGGAAGG + Intergenic
926425299 2:12734263-12734285 CCAAAGAGACAAGGGGTGGAGGG - Intronic
926487986 2:13486683-13486705 CAATAGTGGCAGAAGGTGAAGGG - Intergenic
926715753 2:15922243-15922265 CAAAAGAGGAAGGAAGTGGACGG + Intergenic
927285673 2:21354455-21354477 CCAAAGAGGCAGGGGCTGGAGGG - Intergenic
927482487 2:23465360-23465382 ACAGAGAGGCAGGAGGTGAGAGG - Intronic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
927798598 2:26075389-26075411 ACAAAGAGGGAGGAGGTGGGTGG - Intronic
928104334 2:28458113-28458135 TCATAGAGACAGGAAGTAGAAGG + Intronic
928593599 2:32840405-32840427 CCAAAGAGGCAGCAGCAGGAAGG + Intergenic
929285200 2:40127746-40127768 CCAGAGAGGCAGGATGGGGTGGG + Intronic
929699220 2:44147459-44147481 ACATGGTGGCAGGAGGTGGTGGG - Intergenic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
931143469 2:59489265-59489287 CCATAGAGCCCGGGGATGGAGGG - Intergenic
932344818 2:70988574-70988596 CCATGCAGGCAGGATGTGGGGGG - Exonic
932557004 2:72833325-72833347 GCAAAGAGGCAGGGGTTGGAGGG - Intergenic
934977658 2:98816031-98816053 CCATAGGGGCTGGTGGTGGGGGG + Intronic
936013131 2:108938127-108938149 CCACAGAGGCAGGAAGAGCATGG + Intronic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937265332 2:120611701-120611723 CCATGAAGGCAAGAGCTGGAAGG - Intergenic
937540962 2:122952919-122952941 TCATAGAGGCAGAAAGTAGATGG + Intergenic
938256083 2:129861128-129861150 CCATAGAGGTGAGAAGTGGAGGG - Intergenic
938562669 2:132488792-132488814 CCAGTGAGGCGGGATGTGGATGG - Intronic
938832936 2:135071625-135071647 GCAAAGAGGAAGGAGCTGGAGGG + Intronic
938833403 2:135074847-135074869 ACTAAGAGGCAGGAGCTGGAGGG + Intronic
939341506 2:140901294-140901316 GCAAAGAGGCAGGGGCTGGAAGG - Intronic
939500369 2:142976132-142976154 GCAGAGAGGCAAGGGGTGGAGGG + Intronic
939683314 2:145166501-145166523 CCTTAGAAAGAGGAGGTGGAGGG - Intergenic
940261587 2:151785442-151785464 AGAAGGAGGCAGGAGGTGGAGGG + Intergenic
942075069 2:172350072-172350094 CCATATGGAAAGGAGGTGGAAGG + Intergenic
943822046 2:192337370-192337392 CCTTAGAGCCAAGAGGTGCATGG + Intergenic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
945336738 2:208600981-208601003 ACATGGTGGCAGGAGGTGGTGGG + Intronic
945631756 2:212287129-212287151 GCAAAGAGGCAGGGGCTGGAGGG - Intronic
945819143 2:214641775-214641797 CCAGAGAAGCAGGTGGTAGATGG - Intergenic
945920613 2:215751316-215751338 CCATCCAGGCAGCAGATGGATGG - Intergenic
946382040 2:219355330-219355352 GCAAAGAGGCAGGCTGTGGAGGG + Intergenic
947840725 2:233206121-233206143 GCACAGAGCCAGGAGGTGGGAGG - Intronic
948350776 2:237338933-237338955 CCATAAAGTCAGGAGGTGGTTGG + Intronic
948591591 2:239054022-239054044 TCACAGAGGCTGGGGGTGGAGGG + Intronic
948655668 2:239475479-239475501 GCAGGGAGGCAGCAGGTGGAGGG + Intergenic
1169254779 20:4088700-4088722 GCATAAAGGCTGGGGGTGGAGGG - Intergenic
1169848087 20:10017371-10017393 CCATAGAGACAGGAGATTGGTGG + Intronic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170882144 20:20306088-20306110 CCATAGTGGAAAGAGGTGGGAGG - Intronic
1172358619 20:34296786-34296808 CCAAAGAGGTAGGCGGTGGGAGG + Intronic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1174358528 20:50014145-50014167 CCACAGTGGCAGTAGCTGGACGG - Intergenic
1175390812 20:58626172-58626194 CCAGAGAGGAAGGAAGTGAAGGG + Intergenic
1175465159 20:59185743-59185765 CCACTGAGGCAGGAGCTGGACGG + Intergenic
1177860975 21:26453689-26453711 CAATAGCGTTAGGAGGTGGAAGG + Intergenic
1178098779 21:29243521-29243543 CAAGAGAGGCAGGAGGTGCCAGG + Intronic
1178301548 21:31457790-31457812 CCCTGGAGGCAGGAGGTGGGGGG - Intronic
1178514064 21:33230756-33230778 GCGTGGAGGCAGGAGGGGGAAGG + Intronic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1179015750 21:37593315-37593337 GCAGAGAGGCAGGGGCTGGAGGG - Intergenic
1179484830 21:41703600-41703622 CCATAGAGACAGGAAGTAGAAGG + Intergenic
1179496317 21:41773567-41773589 CCACAGAGGCAGCAAGTAGATGG + Intergenic
1179649292 21:42796403-42796425 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
1179713560 21:43276225-43276247 CCATAGAGACAGCAGGTGAGGGG + Intergenic
1179784328 21:43720871-43720893 CCAATGAAGTAGGAGGTGGATGG - Intronic
1180221981 21:46364991-46365013 CCAAAGAGCCTGGAGCTGGAGGG - Intronic
1180799344 22:18624527-18624549 CCAGAGAGGCAGGACACGGACGG + Intergenic
1181084019 22:20430977-20430999 CCAGGGAGGGAGGAGGTGGAAGG - Intronic
1181222374 22:21370739-21370761 CCAGAGAGGCAGGACACGGACGG - Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1182320262 22:29474238-29474260 CCACAGAGTGAGGTGGTGGAGGG - Intergenic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1182747391 22:32616188-32616210 GCATGGGGGCAGGAGGTGGGGGG + Intronic
1183361144 22:37384144-37384166 GGAGAGAGGCAGGGGGTGGAAGG + Intronic
1184633493 22:45805652-45805674 CCAGAGAGACAGGAAGTAGAAGG + Intronic
1185071518 22:48659285-48659307 CCATGGAGCCAGGAGGTCTACGG + Intronic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
949895527 3:8765303-8765325 CCATAGAGGAGGGAGCTGGGAGG + Intronic
951787848 3:26442743-26442765 AAATAGAGGCAGGAGGTTCAGGG - Intergenic
952242024 3:31541316-31541338 CTATAAAGTCAGGGGGTGGAAGG - Intronic
952735749 3:36690113-36690135 CAATAGAGGCAGGGGGAAGAGGG + Intergenic
952938026 3:38415882-38415904 CAATCGTGGCAGGAGGTGAAGGG + Intronic
955338481 3:58106659-58106681 CCCTAGGGGGTGGAGGTGGAAGG - Exonic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
959553490 3:107690980-107691002 CCTTGGAGCCAGGAGGTAGAGGG - Intronic
959746861 3:109785743-109785765 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
960336066 3:116419132-116419154 CCATAGTGGCAGGAAGCGTAGGG - Intronic
960962954 3:123084848-123084870 CCAGGGAGGCCGGAGGTGGAGGG - Intronic
961459732 3:127042754-127042776 CCAGAGGGGCAGGGGGAGGAGGG - Intergenic
961807843 3:129502091-129502113 CCAAAGAGGGAGGAGCTGCAGGG - Intronic
962282377 3:134061567-134061589 CCAGGGAGGCAGGGGCTGGATGG + Intergenic
963156886 3:142108838-142108860 CCCTTGAGGCAGGAGGAGCACGG - Intronic
964489123 3:157216224-157216246 TGATAAAAGCAGGAGGTGGAAGG - Intergenic
966683385 3:182667433-182667455 CAGTAGCGGCAGTAGGTGGAGGG - Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968969866 4:3788184-3788206 GCAGAGGGGCAGGAGCTGGAGGG - Intergenic
969214743 4:5712513-5712535 CCAAAGAGGCAGAAGTTGCAAGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
969477699 4:7430923-7430945 GCAGAGAGGCAGGAGGAGCAAGG - Intronic
969617884 4:8264339-8264361 CCATAGCAGCAGGAGGCGGCGGG + Intergenic
969881466 4:10177710-10177732 CCATAGAGGCAGAAGCTCCATGG - Intergenic
969978145 4:11126092-11126114 TTAGAGAGGTAGGAGGTGGAGGG - Intergenic
970743231 4:19263078-19263100 GCATAGTGACAGGAGGTGAAGGG + Intergenic
970995157 4:22259115-22259137 TCATAGAGACAGAAAGTGGAGGG + Intergenic
971131933 4:23820998-23821020 CCATAGGTGCAGCAGGTGGGTGG - Intronic
971134658 4:23855152-23855174 CAATTGTGGCAGGAGGTGAAAGG - Intronic
971141764 4:23932327-23932349 CCCTGGAGGCAGGAGGAGGATGG - Intergenic
972384415 4:38550742-38550764 CAATAATGGCAGGAGGTGAAAGG - Intergenic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
979119089 4:116870803-116870825 GCAGAGAGGCAGGGGCTGGAGGG + Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
981476701 4:145194430-145194452 CCATAGAGACAGAAAGTAGAGGG + Intergenic
982064861 4:151645208-151645230 CCATGGAGACAGTAGGAGGAGGG + Intronic
982266411 4:153542259-153542281 CCACAGAGGTAGGAGGTAGTGGG + Intronic
984349411 4:178571030-178571052 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
986052120 5:4099899-4099921 TCCTAGAGGCAGGAGGTTGGTGG - Intergenic
988537963 5:32085976-32085998 CCAGAGAGTGAGGAGGAGGAAGG - Intronic
988645155 5:33086823-33086845 CTATATAGGAAAGAGGTGGAGGG + Intergenic
989169125 5:38457906-38457928 CCACAGAGTCAGAAGGTAGAAGG + Intronic
990376252 5:55173438-55173460 CCACCGCGGCAGGAGGCGGAGGG + Intergenic
991037681 5:62144388-62144410 CCATCTGGGAAGGAGGTGGAAGG + Intergenic
992472789 5:77075030-77075052 TCATAGAGGCAGGATGTGCAAGG + Exonic
992877827 5:81075362-81075384 GCAGAGAGGCAGGGGCTGGAGGG + Intronic
995815384 5:116161795-116161817 GAATAGACGGAGGAGGTGGAAGG + Intronic
996453568 5:123655376-123655398 ACATAGTGGCAGGAGGAGTAGGG + Intergenic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
997733233 5:136195388-136195410 TCATAGTGGCAGGACGGGGATGG + Intergenic
998241042 5:140444960-140444982 CTCTAGAGGCAAGAGGTGGGAGG - Intronic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
999115695 5:149161358-149161380 CCATGGAGGAAGTAGGTGGAGGG - Intronic
999273078 5:150309387-150309409 CCAGCGTGGCAGGGGGTGGAGGG - Intronic
999275337 5:150326176-150326198 CCAGAGAGGCATGGAGTGGAGGG - Intronic
999495443 5:152092008-152092030 AAATTGAGGCAGGAGCTGGAAGG - Intergenic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
1000223529 5:159236500-159236522 GCTTAGACCCAGGAGGTGGAGGG - Intergenic
1000263745 5:159615314-159615336 CTCTAGAGGCGGGAGGGGGAGGG - Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1000633596 5:163618167-163618189 CAATAAGGGCAGCAGGTGGAGGG + Intergenic
1002360630 5:178667875-178667897 CCAGAGAGGGAGCTGGTGGAAGG + Intergenic
1002367435 5:178724173-178724195 GGAGGGAGGCAGGAGGTGGAAGG - Intronic
1002386014 5:178867997-178868019 GGAGGGAGGCAGGAGGTGGAAGG + Intronic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1003597221 6:7484760-7484782 CCATAGAGACAGAAAGTAGAAGG - Intergenic
1003602102 6:7526984-7527006 CCATGGAGGCTGGAGGGGGAAGG - Intergenic
1004013493 6:11711242-11711264 CCATAGAAACAGGAGCTGCAAGG + Intergenic
1004272579 6:14209115-14209137 TCCTAGAGGCAGGAGTTTGAGGG + Intergenic
1006743677 6:36326509-36326531 CCATAGCTGCTGGAGATGGAAGG + Exonic
1006902539 6:37512480-37512502 GGATGCAGGCAGGAGGTGGAAGG - Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG + Intergenic
1008052345 6:46913137-46913159 CCAGAGAGGCAGGAACAGGAGGG + Intronic
1008349119 6:50468009-50468031 CCAGAGAGGCAGGAGTGAGAAGG - Intergenic
1009556553 6:65178205-65178227 GCAAAGAGGCAGGAGCTAGAGGG - Intronic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1010280431 6:74017482-74017504 TCATAAAGGCAGGGAGTGGAAGG - Intergenic
1010378583 6:75202712-75202734 CCATTGAGGCAGAAGGTAAAAGG - Exonic
1010395716 6:75389929-75389951 CCTTAGAGCAAGGAGGTGAAGGG - Intronic
1010732236 6:79403505-79403527 TCCTAGACCCAGGAGGTGGAGGG + Intergenic
1010832714 6:80550961-80550983 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
1011125369 6:84001625-84001647 GCATGTAGACAGGAGGTGGAAGG - Intergenic
1011163458 6:84419111-84419133 CAATAGAGGTAGAAGGTGCAGGG - Intergenic
1011529323 6:88302773-88302795 AGACAGAGGCAGGAGATGGAGGG + Intergenic
1011700398 6:89950109-89950131 CCACAGAGGCAGGATGCTGAAGG - Intronic
1011753543 6:90476680-90476702 CCCTAGAGGCAGGAGGGGGGTGG - Intergenic
1012008916 6:93754745-93754767 CCATAGAGGCAGAGATTGGAGGG + Intergenic
1012502519 6:99904709-99904731 CCAAAGAGGCAGGAGGCAAAAGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1016564422 6:145437220-145437242 ACATGGAGGCAGGAGGGGGGCGG - Intergenic
1016739750 6:147514335-147514357 CCAGTGAGGGAGGAGATGGAAGG + Intronic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1017653177 6:156601556-156601578 CCCTAGAGGCCAGAGGTTGATGG - Intergenic
1019507585 7:1400351-1400373 CCATAGAGACAGAAGTAGGAAGG - Intergenic
1019808158 7:3144154-3144176 ACATAGAGGCATGGGGTGGGGGG + Intronic
1022271118 7:28809156-28809178 CCAGAGAGGGAGGAGGTGATGGG - Intronic
1022780712 7:33579756-33579778 ACTTAGAGTGAGGAGGTGGAGGG - Intronic
1022902516 7:34825029-34825051 CTCAGGAGGCAGGAGGTGGAGGG - Intronic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023947052 7:44811491-44811513 CCATAGTGACAGGAGGAGGGAGG - Intronic
1026793170 7:73348417-73348439 CTATACAGGGAGGATGTGGACGG - Intronic
1026913613 7:74106923-74106945 GCATGCAGGCAGGAGGAGGAAGG + Intronic
1027358597 7:77384836-77384858 CTCTAGAGGCAGGAGGGAGAAGG + Intronic
1028796853 7:94912329-94912351 CAATAGGGGCAGGAGGTGGTTGG + Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031526371 7:122826007-122826029 CCATGGACACAGGAGGTGGTAGG - Intronic
1031806683 7:126316166-126316188 ACATGGTGGCAGGAGGAGGAGGG + Intergenic
1032119885 7:129148160-129148182 CCAGCGAGGAAGGAGGTGGGCGG - Intronic
1032200573 7:129819846-129819868 CCATTCAGGCAGGAAATGGAAGG - Intergenic
1032624349 7:133573735-133573757 CACTAGAGGCCGGGGGTGGAAGG - Intronic
1033157474 7:138969317-138969339 CCATGGAGACAGGAAGTAGAAGG - Intronic
1033415720 7:141159769-141159791 TCATAGAGACAGAAGGTAGAAGG + Intronic
1033812427 7:145031351-145031373 GCATAAAGGCAGGATGTGGGTGG + Intergenic
1034120339 7:148621035-148621057 CAAGAGAGGCAGTAGGTCGAAGG - Intergenic
1034281707 7:149859239-149859261 CCAAAGAGGCAGTAAGGGGAGGG - Intronic
1034535870 7:151725341-151725363 GCATAGAGACAGGAAGTAGAAGG + Intronic
1034943073 7:155244519-155244541 CCATGGAGACAGGAAGTAGAGGG + Intergenic
1034991351 7:155549779-155549801 CCATAGTGGCAGGGGCTGGTAGG - Intergenic
1036565416 8:9933991-9934013 ACATGGAGGCAGGAGGCGGGAGG + Intergenic
1036687727 8:10923100-10923122 CCACAGAAGCAGGAGGGGTATGG - Intronic
1038310017 8:26439312-26439334 CCTGAGAGGCAGGAGGTGCTTGG + Intronic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038950567 8:32409988-32410010 CCTTAGAGGCAGGGTTTGGAGGG - Intronic
1039807435 8:41012633-41012655 GCATAGAGGCAGAGGCTGGAGGG - Intergenic
1040421533 8:47244352-47244374 CACTAGAGGTAGGTGGTGGATGG - Intergenic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1044170799 8:89049686-89049708 CCATGGTGGCAGGAGGTGGCAGG + Intergenic
1044398350 8:91741119-91741141 CCATGGAGGCAGTAGGTCTAAGG + Intergenic
1044467267 8:92522115-92522137 CCACAGAAACAAGAGGTGGAGGG - Intergenic
1044558969 8:93594010-93594032 ATATAGTGGCAGGAGGTGGCAGG - Intergenic
1044931518 8:97256652-97256674 CCATAGAGACAGGAAGCAGATGG + Intergenic
1045343393 8:101273654-101273676 ACATAGAGGCAAGATGTGGAGGG + Intergenic
1046131671 8:109974551-109974573 CCCTAGCGGCAGGAGGAGGAAGG - Exonic
1046133076 8:109992597-109992619 GCAAAGAGGCAGGGGCTGGAGGG - Intergenic
1046645094 8:116777200-116777222 CTCTAGAGGCAGGATCTGGAAGG + Intronic
1047425764 8:124744774-124744796 CCATAGAGACAGAAAGTTGAAGG - Intergenic
1047425903 8:124746762-124746784 CCATAGAGACAGAAAGTTGAAGG - Intergenic
1047959064 8:129997695-129997717 ACCTAGTGGCAGGAGGGGGAGGG - Intronic
1048267865 8:133003737-133003759 GCAAAGAGGCAGGAGGTGATGGG - Intronic
1048619806 8:136119219-136119241 CCATAAAGGGAGGATGAGGAGGG - Intergenic
1048641747 8:136370586-136370608 TGATAGAGGCAGGAGGCAGATGG - Intergenic
1049253189 8:141600192-141600214 ACCTAGAGGCTGGAGGGGGAAGG + Intergenic
1049573289 8:143379436-143379458 CCATGGAGGCAGGTGGTGAGAGG - Exonic
1049591590 8:143465291-143465313 CCAGGAAGGCAGGGGGTGGACGG - Intronic
1051823270 9:21192446-21192468 ACATACATGCAGGAGGTGGCTGG - Intergenic
1051825089 9:21210982-21211004 ACATACATGCAGGAGGTGGCTGG - Intronic
1051827078 9:21233045-21233067 ACATACATGCAGGAGGTGGCTGG - Intronic
1052077327 9:24159238-24159260 TCATAGATAGAGGAGGTGGAGGG - Intergenic
1052381110 9:27772015-27772037 CCATAGAGACAGCTGGAGGATGG - Intergenic
1053045561 9:34913704-34913726 CTATAGAGGCAGGAGATTGGAGG - Intergenic
1053493457 9:38529640-38529662 GCCTAGAGGCATGAGGTGTAAGG + Intergenic
1054854690 9:69885772-69885794 TCATAGAGGCAGGAAGTTGGTGG + Intronic
1055030355 9:71767804-71767826 ACAGAGAGGCAGGGGGCGGAGGG + Intronic
1055610487 9:78019392-78019414 ACATGGAGTCTGGAGGTGGAAGG - Intronic
1056958507 9:91101601-91101623 CCCTACAGGCAGGAGGGGGACGG - Intergenic
1056977334 9:91270351-91270373 CCAAAGAGAAAGGAGGTGGAGGG + Intronic
1057391502 9:94644689-94644711 CCCTGGAGGCATGACGTGGAGGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058702893 9:107615218-107615240 TCATGCAGTCAGGAGGTGGAAGG + Intergenic
1058901222 9:109443898-109443920 GCATGGAACCAGGAGGTGGAGGG - Intronic
1059076096 9:111195576-111195598 CCATAGAGGCAACAGGGGCATGG - Intergenic
1059081830 9:111258082-111258104 CAGTTAAGGCAGGAGGTGGAAGG + Intergenic
1059162347 9:112047154-112047176 CCATCAAGGCAGAAGGTGAAGGG + Intronic
1059238516 9:112783203-112783225 CCATGGAGGCAGACGGTGAAGGG + Intronic
1059409495 9:114123274-114123296 GCATACAGGCAGGAGGTGGTGGG + Intergenic
1059689412 9:116670345-116670367 CCACAAGGGCAGGAGGTAGAAGG + Intronic
1060937951 9:127526857-127526879 CCAGTGAGGAAGGAGGTGGCAGG + Intronic
1061434837 9:130554655-130554677 CCATTGAGGCAGGGGATGCAGGG + Intergenic
1061582295 9:131545614-131545636 CCATGGAGGCAGGAGCTGGAGGG + Intergenic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062151264 9:135020375-135020397 CCATAGAAGCTGGAGGAGGCAGG + Intergenic
1062410586 9:136422178-136422200 CCAAGGAGGCAGCAGGTGCATGG - Intronic
1185472822 X:394888-394910 CCATGGAGGCAGAAAGTGGATGG - Intergenic
1185639019 X:1576213-1576235 ACCTTGAGGTAGGAGGTGGAGGG - Intergenic
1185673640 X:1831190-1831212 CCCTGGAGGCAGGAGGAGGCAGG + Intergenic
1186261488 X:7784732-7784754 CCATAGAGACAGAAAGTGGATGG + Intergenic
1186276731 X:7947245-7947267 GCCAAGAGGCAGGGGGTGGAGGG - Intergenic
1186467378 X:9794263-9794285 GCAAAGAGGCAGGGGCTGGAGGG - Intronic
1187427100 X:19187901-19187923 GCAAAGAGGCAGGGGCTGGAGGG + Intergenic
1187526700 X:20060993-20061015 CCAGAGAGGCAGGATTTGGTGGG + Intronic
1187697326 X:21935491-21935513 CCATAGAGACAGGAAGCGGGGGG - Intergenic
1187961377 X:24569707-24569729 TTATAGAGGCAGGAAGTAGAAGG + Intronic
1188754636 X:33947400-33947422 GGATAGAGGTAGGAGGAGGAAGG - Intergenic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189546996 X:42051610-42051632 GGAGAGAGGGAGGAGGTGGAAGG - Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1190088469 X:47416962-47416984 GCAAAGAGGCAAGAGCTGGAGGG + Intergenic
1190739653 X:53280689-53280711 CGCAGGAGGCAGGAGGTGGAGGG - Intronic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1192182150 X:68922775-68922797 CAAGTGAGGCAGGAGGTGGCTGG + Intergenic
1192638424 X:72842692-72842714 CCACAGCGGCGGGAGGTCGAAGG + Intronic
1192643290 X:72878116-72878138 CCACAGCGGCGGGAGGTCGAAGG - Intronic
1194665649 X:96674764-96674786 CCAGAGAGGGAGGACCTGGAAGG - Intergenic
1197715296 X:129702045-129702067 CCAGAGAGGCGGGATGTGGTAGG + Intergenic
1198242367 X:134798350-134798372 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1198243064 X:134803193-134803215 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1198600755 X:138282679-138282701 CCATCCAGGAGGGAGGTGGAGGG - Intergenic
1199540035 X:148948585-148948607 GCAAAGAGGCAGGGGCTGGAGGG + Intronic
1199841225 X:151651411-151651433 CCATTGTGTCAGGAGGTGGCAGG + Intronic
1199970802 X:152859413-152859435 CCATAGAGACAGAAAGTAGAAGG - Intronic
1200047341 X:153409919-153409941 CCATGGAGGCAGGGGGCGGGGGG - Intergenic
1200179535 X:154141798-154141820 CCATAGAGACAGACAGTGGAAGG - Intergenic
1201144684 Y:11057758-11057780 CAATAGAGGCAGAAGGCTGAGGG + Intergenic
1202356397 Y:24054631-24054653 CCATGGAGTCAGAAGGTGGTGGG - Intergenic
1202514381 Y:25615478-25615500 CCATGGAGTCAGAAGGTGGTGGG + Intergenic