ID: 1140078599

View in Genome Browser
Species Human (GRCh38)
Location 16:71723830-71723852
Sequence TCCAGCGGGCCCGCGGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 238}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140078584_1140078599 19 Left 1140078584 16:71723788-71723810 CCCGGCCGGCGGCTCGCGGGCGC 0: 2
1: 0
2: 2
3: 30
4: 228
Right 1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 1
3: 27
4: 238
1140078577_1140078599 30 Left 1140078577 16:71723777-71723799 CCCGGATCCCTCCCGGCCGGCGG 0: 1
1: 1
2: 1
3: 18
4: 140
Right 1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 1
3: 27
4: 238
1140078585_1140078599 18 Left 1140078585 16:71723789-71723811 CCGGCCGGCGGCTCGCGGGCGCT 0: 2
1: 0
2: 1
3: 12
4: 113
Right 1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 1
3: 27
4: 238
1140078580_1140078599 23 Left 1140078580 16:71723784-71723806 CCCTCCCGGCCGGCGGCTCGCGG 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 1
3: 27
4: 238
1140078582_1140078599 22 Left 1140078582 16:71723785-71723807 CCTCCCGGCCGGCGGCTCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 1
3: 27
4: 238
1140078586_1140078599 14 Left 1140078586 16:71723793-71723815 CCGGCGGCTCGCGGGCGCTTCGG 0: 1
1: 1
2: 0
3: 8
4: 67
Right 1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 1
3: 27
4: 238
1140078579_1140078599 29 Left 1140078579 16:71723778-71723800 CCGGATCCCTCCCGGCCGGCGGC 0: 1
1: 1
2: 1
3: 21
4: 141
Right 1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG 0: 1
1: 0
2: 1
3: 27
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140078599 Original CRISPR TCCAGCGGGCCCGCGGGCCC CGG Intronic
900287495 1:1908651-1908673 CCCAGCGCGCCCGGTGGCCCAGG - Intergenic
900497549 1:2982876-2982898 CCCAGCAGGCCCGCGTGGCCTGG - Intergenic
900626511 1:3611079-3611101 TCCAGAGGCCCCGGGGTCCCTGG + Intronic
901085997 1:6613096-6613118 TGCTCCGGGCCCGCGGGGCCGGG - Intronic
901802950 1:11719692-11719714 TCTAGCGGCCCCGCGGGACTGGG + Exonic
904044902 1:27603221-27603243 CCCAGCCGAGCCGCGGGCCCCGG + Intronic
906214439 1:44030714-44030736 TCCCGCGGGCGCACGGGCACTGG + Intronic
906551307 1:46668368-46668390 TGGAGCGGGCGCGCGGGCCGCGG - Exonic
906678725 1:47710714-47710736 TCCAGCAGGACCGCGGGACACGG - Intergenic
906680924 1:47725109-47725131 CCCAGCCAGCCCGCGCGCCCAGG - Intergenic
907092191 1:51735419-51735441 TCCACCGGGCTAGTGGGCCCTGG - Intronic
912337633 1:108877205-108877227 TCCCGCGGGCGGGCGGGTCCCGG - Exonic
912502278 1:110130349-110130371 TCCAGCGGTCCCCCGCCCCCAGG - Intergenic
919049795 1:192499316-192499338 GCCAGCCGGCCCACCGGCCCAGG - Intergenic
920250459 1:204619231-204619253 ACCAGCTGGCCCGGGTGCCCAGG - Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924421876 1:243917351-243917373 TCCCGCGGGCCCCCGAGGCCGGG + Intergenic
1063393682 10:5666599-5666621 CCCAGCGGCCCCGCGCGGCCCGG - Intergenic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1071661291 10:87505238-87505260 TGCTGCAGGCCCGCGGGTCCAGG + Exonic
1072003648 10:91221081-91221103 AGCAGCGCGCCCGCGGGGCCTGG + Intronic
1072139058 10:92573882-92573904 CCCACGGGGCCCGAGGGCCCGGG + Intronic
1072634208 10:97166920-97166942 GCCATCTGACCCGCGGGCCCAGG + Intronic
1075305711 10:121365673-121365695 GCCGGCGGGCCTGCCGGCCCCGG + Intergenic
1076479930 10:130778262-130778284 TCCCGTGGGCTGGCGGGCCCAGG - Intergenic
1077105954 11:842732-842754 TGCCGCGGCCGCGCGGGCCCGGG - Intergenic
1078091728 11:8268383-8268405 TCCCGCGTGCCCCCGGGCACCGG + Intronic
1078594479 11:12674664-12674686 CCCAGCGCGCCAGCCGGCCCCGG + Exonic
1079078422 11:17397514-17397536 ACCAGCAGGCCCCAGGGCCCAGG - Intronic
1082028617 11:47589585-47589607 TACTGCGGGCCCGCAGGCCCGGG - Intergenic
1082283631 11:50298128-50298150 TCCCGGGGGTCCCCGGGCCCTGG + Intergenic
1083579007 11:63813319-63813341 TCTAACGGGGCCGCGTGCCCGGG + Intergenic
1083814115 11:65122396-65122418 TCCAGCGGGGCTGCGGGCTACGG + Exonic
1083842824 11:65314694-65314716 TCCAGCGGTCGCGCGCGCCCTGG - Intergenic
1089521542 11:119067730-119067752 TTCCGGGAGCCCGCGGGCCCAGG - Exonic
1089533941 11:119149457-119149479 ACCCCCGGGCCCGCGTGCCCCGG - Intronic
1091550307 12:1531037-1531059 CCCAGCGCGGCCGCGGGGCCGGG - Intronic
1092101701 12:5889111-5889133 ACCAGCCGGCCCGCCGGCCGTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096647684 12:53047448-53047470 TCCGGCGGCCCCGCGCCCCCTGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1103392523 12:120584768-120584790 TCCAGCGGATCTCCGGGCCCCGG - Intergenic
1103415519 12:120739748-120739770 TCCCGCGGGCCCTGGTGCCCTGG + Exonic
1103509740 12:121466651-121466673 GCCGTCGGGCCCACGGGCCCCGG + Intronic
1106555154 13:30803103-30803125 TCCTGCGGGCTCCCGCGCCCTGG + Intergenic
1109284945 13:60397844-60397866 TCCTATGGGCCCGCGGGCTCCGG - Intronic
1113895105 13:113759285-113759307 TCCAGCAGGCCCAGGGGCCCGGG - Exonic
1114483248 14:23048047-23048069 TCCAGCGGCTCCGCGGGGCCGGG + Exonic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1121957631 14:98228525-98228547 GCCAGCGGGTCCGCCTGCCCTGG - Intergenic
1122316173 14:100827224-100827246 CCCACCAGGCCCGCCGGCCCAGG - Intergenic
1123019235 14:105389845-105389867 TCCGGCAGGGCCGCGGCCCCAGG + Intronic
1123412743 15:20073407-20073429 TCCAGCGGGCAGGCGGGGCTTGG - Intergenic
1123522085 15:21080520-21080542 TCCAGCGGGCAGGCGGGGCTTGG - Intergenic
1127103345 15:55588570-55588592 AGCCGCGGGCCCGCGAGCCCCGG - Intronic
1127588305 15:60398114-60398136 CCCTGCGGGCCGGCGGGCCGGGG - Intronic
1129823740 15:78620954-78620976 TCCCGCGGGTCCGAGGGCGCTGG - Exonic
1130537542 15:84798058-84798080 TCCACAGGGCCTGCTGGCCCTGG - Intronic
1131827977 15:96334918-96334940 CCCAGCAGGCCCGGGGGGCCTGG - Intronic
1132314560 15:100880243-100880265 TCCAGCGCCCGCGCGGGGCCGGG + Intronic
1132544737 16:527958-527980 GCGAGCGGGCCCGGGGGCCGGGG + Exonic
1132700491 16:1220170-1220192 TCCAGCCGGCCGGCGGCCCCAGG + Exonic
1132793508 16:1706760-1706782 TCCAGGGGTCCCGCGGTCCGGGG - Intronic
1132807613 16:1782332-1782354 TCCCGCGGGCGCGCGGGTTCCGG + Intronic
1132880974 16:2161545-2161567 TGCAGCTGGCCCTGGGGCCCCGG + Intronic
1132893175 16:2214500-2214522 TTCGGCGGCCCCGCGGGGCCCGG - Exonic
1133023095 16:2975449-2975471 TGCAGCGGCCCCGGGGCCCCAGG + Exonic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1133031636 16:3013931-3013953 TCGAGCGGCCCCGCGGACCTCGG + Exonic
1133784486 16:8963725-8963747 CGCGGCGGGCCTGCGGGCCCTGG + Intronic
1135115332 16:19718595-19718617 GGCAGCGGCTCCGCGGGCCCGGG + Intronic
1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG + Exonic
1137388299 16:48060148-48060170 TTCAGCGGTCCCGCGGGCCCCGG + Intergenic
1137475988 16:48810755-48810777 TCCAGCTTCCCCGCGGGTCCGGG + Intergenic
1138450814 16:57092678-57092700 TCGGCCGGGCCCGCGGGCGCGGG - Exonic
1138688761 16:58748952-58748974 GCCAGCCAGCCCGCCGGCCCCGG + Intergenic
1139664486 16:68446988-68447010 TCTAGCGGGCCCGCGCGAGCCGG - Intronic
1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG + Intronic
1141280674 16:82627633-82627655 ACCAGGGGGCCCGGGCGCCCTGG - Intronic
1142638513 17:1271836-1271858 TCCAGTGGGCCCCGTGGCCCAGG + Intergenic
1142757752 17:2025657-2025679 TCCAGGAGGCCTGCGGGGCCGGG - Intergenic
1142900446 17:3008232-3008254 TCCAGCTGGCCCTTGGGCTCTGG - Intronic
1143784295 17:9245169-9245191 ACCAGCGGCCCCGCTGGCCCTGG - Intergenic
1144767322 17:17739844-17739866 TCCAGCTGGCCAGTGGGCCACGG + Intronic
1145941077 17:28743782-28743804 TCCCCGGGGCCCGCGGGCTCTGG + Intergenic
1145941082 17:28743785-28743807 TCCCCAGAGCCCGCGGGCCCCGG - Intergenic
1146797895 17:35795603-35795625 GCCCGCGGGTCCGCCGGCCCCGG + Intronic
1147179126 17:38673906-38673928 TCCACCGAGCCCGCGGGTCCCGG - Exonic
1147336649 17:39730355-39730377 TCCGTCCGGCCCGCGGGACCAGG + Intronic
1148608008 17:48944741-48944763 GCCGGGCGGCCCGCGGGCCCAGG - Exonic
1148907900 17:50922893-50922915 TCCAGGGGCCCCCTGGGCCCAGG - Intergenic
1150452229 17:65278713-65278735 TCCAGCAGGCCTGTGGGCACAGG + Intergenic
1151684305 17:75637748-75637770 TCCAGGGGGCTCTCGGGCCCTGG + Exonic
1152595458 17:81235683-81235705 TTCAGCGGGCCAGAGGGCCCCGG - Intronic
1152627474 17:81394168-81394190 CCCAGCGGTCCCGCGGGAGCGGG + Intergenic
1152782141 17:82231266-82231288 TCCAGCCGTCCCTCCGGCCCGGG + Intronic
1152809541 17:82375061-82375083 TCAAGCGGGCCCGGCGGCCGGGG + Exonic
1154304261 18:13218651-13218673 TGAAGCGGGCCCGAGGGGCCGGG - Intronic
1156350483 18:36297803-36297825 TGCCGCGGGGGCGCGGGCCCCGG - Intronic
1158453381 18:57586458-57586480 TCCCCCGGGCGCGAGGGCCCGGG + Intronic
1160514463 18:79470821-79470843 TGCAGGGGGCCCCCGGGCTCAGG + Intronic
1160775443 19:853137-853159 TCGAGGGGCCCCGCGGGCCCTGG - Intronic
1160913660 19:1486922-1486944 CCCAGCAGGGCCGCGTGCCCTGG - Exonic
1161233328 19:3186358-3186380 TCCAGGGCGCCCGGGGGTCCAGG - Intronic
1161480506 19:4508019-4508041 TCCAGGGAGCCCGCAGGGCCTGG - Intronic
1163358313 19:16829457-16829479 GCCGGCGGCCCCGCGGGCCGGGG + Exonic
1163630943 19:18417673-18417695 TCCCGCGGGCCTCCGGGCCCCGG - Intergenic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165089249 19:33374001-33374023 CCCAGACGGCCCGCTGGCCCGGG + Intronic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1166317882 19:41998890-41998912 TCCCGGGGGCCGGCGGGGCCAGG + Exonic
1166361495 19:42254593-42254615 TCCACCGGGCCCGCTATCCCTGG - Intronic
1167376454 19:49114663-49114685 ACCAGCGGCCCTGCGGCCCCGGG - Intronic
1167781367 19:51601253-51601275 TCCTGCGGGGCGGCTGGCCCGGG + Intergenic
1168076291 19:53982442-53982464 CCCGGCGGCCCCGGGGGCCCGGG + Exonic
925169873 2:1744062-1744084 CCCAGCGGGTCCCCGCGCCCAGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
932191184 2:69742330-69742352 TGGAGGGGGCCAGCGGGCCCTGG + Intronic
932599241 2:73112682-73112704 TGCTGCGGGCCCGCGGGCTGCGG - Exonic
932731848 2:74227162-74227184 CCCAGCGGGCCCTCGGGGTCTGG - Intronic
934670393 2:96208724-96208746 TCCAGCGGGCGCCCGGGGCCGGG + Exonic
935137588 2:100321567-100321589 ACCTGCGGCCGCGCGGGCCCTGG + Exonic
938073925 2:128322224-128322246 TCGCGCGGACCCGCGGGGCCCGG + Intergenic
938368815 2:130756207-130756229 TCCAGGGGCCCCGCGGGGTCGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942460560 2:176165412-176165434 TGCGGCGGGCCGGCGGGCCCGGG + Intronic
945080830 2:206085418-206085440 TCCCGCGGGGCGGCAGGCCCGGG - Intronic
946308823 2:218871646-218871668 TCCGGGGAGCCCGCGGGGCCAGG - Exonic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947724478 2:232388424-232388446 TCGAGCGGGCCCGCTAGTCCTGG - Intergenic
948207114 2:236168194-236168216 TCCGGCGAGCCCTCGGGGCCCGG - Exonic
948232139 2:236356383-236356405 CCCAGCAGACCCGCTGGCCCAGG + Intronic
948232305 2:236358937-236358959 CCCAGCAGACCCGCTGGCCCAGG - Intronic
948430317 2:237914319-237914341 TTCAGCAGCCCCGCGGCCCCCGG + Intergenic
948467415 2:238159012-238159034 TCCGGCGGGGCGGCGGGCCGGGG - Exonic
948544419 2:238716872-238716894 AGCAGCGGGGCCGCGGGACCAGG + Intergenic
948599543 2:239100562-239100584 TCCAGCCGTTCCTCGGGCCCTGG + Intronic
1168954516 20:1825818-1825840 TCCAGCGGCCCCCAGGACCCAGG + Intergenic
1171367428 20:24635160-24635182 TCCTGCTGGGCCGTGGGCCCAGG + Intronic
1171430685 20:25081735-25081757 GCCAGCGGGGCAGCGGGCTCGGG + Exonic
1172428576 20:34872691-34872713 CTCAGCGGGGCCGCGGGCGCCGG + Exonic
1174412943 20:50347677-50347699 TCCAGAATGCCCGAGGGCCCAGG - Intergenic
1175893436 20:62325372-62325394 CCCAGCAGGCCAGGGGGCCCTGG - Exonic
1176546892 21:8206105-8206127 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1176554797 21:8250314-8250336 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1176565843 21:8389152-8389174 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1176573718 21:8433339-8433361 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1180748712 22:18110377-18110399 TGCAGCGGGCCCGGGTGCCAAGG - Intronic
1180833673 22:18919239-18919261 CCCAGCGGGCCCCAGGGTCCAGG - Intronic
1180957187 22:19746321-19746343 TCCATGGGGCCCGCGGGCCTGGG + Intergenic
1181066156 22:20307015-20307037 CCCAGCGGGCCCCAGGGTCCAGG + Intergenic
1181768852 22:25111510-25111532 GCCAGGGGACCCGGGGGCCCTGG + Intronic
1183675533 22:39297098-39297120 CCCAGCGGGCCCGTGGGAGCTGG - Intergenic
1183720173 22:39557873-39557895 GGCGGCGGGCCCGGGGGCCCGGG - Intergenic
1183780354 22:39995234-39995256 TCCAGGCGGCCCGCAGGGCCTGG - Exonic
1184244600 22:43229549-43229571 TGCAGCTGGCCCCAGGGCCCTGG + Intronic
1184568867 22:45309860-45309882 ACCAACGGCCCCGCGGTCCCCGG - Intronic
1184698127 22:46150805-46150827 TCCCGGGGACCCGGGGGCCCGGG + Intronic
1184865385 22:47199252-47199274 TACAGCGGGCTCTCAGGCCCAGG - Intergenic
1203251767 22_KI270733v1_random:122390-122412 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1203259817 22_KI270733v1_random:167472-167494 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1203283759 22_KI270734v1_random:144537-144559 CCCAGCGGGCCCCAGGGTCCAGG - Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950717739 3:14861789-14861811 TCCAGCAAGCCTGCGGGACCTGG - Intronic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
951555386 3:23916526-23916548 TCCAGCAGGCCCCAGCGCCCAGG - Exonic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953748929 3:45595128-45595150 CCCAACGGGCCTGTGGGCCCAGG - Exonic
954076910 3:48188189-48188211 GCCAGCGGGCGGGCGGGCGCCGG + Exonic
954305675 3:49724108-49724130 GCCAGCTGACCCGCGGGTCCCGG - Intergenic
954713110 3:52514603-52514625 TCCAGGGAGCCCCCCGGCCCTGG + Intronic
958892123 3:99794739-99794761 CCCAGGGGGCCCTGGGGCCCAGG - Exonic
959398272 3:105868676-105868698 TCTTGCCGGCCCGGGGGCCCGGG - Intronic
959591959 3:108091176-108091198 TGGAGCGGGCAGGCGGGCCCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960987519 3:123290461-123290483 CCCAGCGGGCACGCCGGGCCTGG - Intronic
961462888 3:127064147-127064169 TGCTGAGGGCCTGCGGGCCCAGG + Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963081846 3:141402241-141402263 ACCCGCAGCCCCGCGGGCCCGGG - Intronic
965429502 3:168568764-168568786 TCCAGGGGGCCAGGGGGCCAGGG - Intergenic
966402736 3:179563423-179563445 TCTAGCCGGCCGCCGGGCCCCGG + Intronic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
968042146 3:195597681-195597703 TCCAGGAGGCCCTCAGGCCCTGG - Intergenic
968236285 3:197031719-197031741 TACATCGGGCCCGTTGGCCCAGG + Intergenic
968471496 4:784640-784662 TCCACCGGGCCCAGGGCCCCAGG - Intergenic
968573716 4:1355322-1355344 TCCGCCGGGCCCACAGGCCCAGG - Intronic
968764845 4:2462894-2462916 TCCAGGCGGCGCGCGGGCCCGGG - Exonic
970188091 4:13484045-13484067 TCGAGCAGGCCCGCCGTCCCAGG - Intronic
976830309 4:89307719-89307741 TCCGGCGGGCCCGCGAGCTGAGG + Exonic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
985212807 4:187613286-187613308 TCCTGCCGCCCCGCGGGCCCTGG - Intergenic
985445547 4:190019379-190019401 CCGAGCGTGCCCACGGGCCCCGG - Intergenic
985662477 5:1164075-1164097 TCCTGCGGCCCTGTGGGCCCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
989209144 5:38842977-38842999 TTCAGGGGGCCCTGGGGCCCTGG + Intergenic
991054427 5:62306272-62306294 TCCTGCCGGCCTGCAGGCCCGGG + Intronic
992089880 5:73307354-73307376 CCCAGCAGGCCACCGGGCCCAGG + Intergenic
992106295 5:73451484-73451506 ACCTGCGGGCCCTCGCGCCCGGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
998095079 5:139392195-139392217 TGCCGAGGGCCTGCGGGCCCGGG + Exonic
1001159531 5:169300975-169300997 GCCCGCGGGCCAGCGGGGCCAGG - Intronic
1002043834 5:176531388-176531410 GCCAGCGGCTCAGCGGGCCCAGG - Intronic
1002487617 5:179550529-179550551 CCCAGCGGGCGGGCGGGCGCGGG - Intergenic
1005894187 6:30163898-30163920 CCCAGCGGGCCCAGGGGCACAGG - Exonic
1006787497 6:36678530-36678552 TCCAGCAGGCCAGCCGGTCCCGG - Intronic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1010585225 6:77650522-77650544 TCAAGCGGGCACGGGAGCCCTGG - Intergenic
1010694169 6:78949476-78949498 TCCAGTGGGCCCTGGGGCACAGG - Intronic
1012733545 6:102910904-102910926 GCCGGCGGGCCCGCAAGCCCGGG - Intergenic
1015904993 6:138107552-138107574 ACCAGCGGCCCCGCCCGCCCCGG - Intergenic
1018686262 6:166307231-166307253 CCCAGCGGGCCTGCGGGGACAGG - Exonic
1019537578 7:1537271-1537293 GGCAGTGGGCCCGGGGGCCCAGG + Intronic
1020006061 7:4784335-4784357 CACAGCGGCCCCGAGGGCCCGGG + Exonic
1022923353 7:35037483-35037505 TCCAGCGGGCGGGCGGGCGGAGG + Intronic
1026471159 7:70694761-70694783 TCCAGCGCGGCCGAGGCCCCGGG - Intronic
1026665528 7:72337120-72337142 TCCAGCGGGGCCTCGGCCACTGG - Intronic
1027190802 7:75994542-75994564 CCCAGCGGGCCCGGGGGCGGGGG + Exonic
1029461051 7:100694080-100694102 CCCAGTGGCCCCGCGGCCCCCGG - Intergenic
1029640162 7:101815652-101815674 TCCAGCGCCCCCTCGGGGCCGGG + Intergenic
1030033340 7:105388539-105388561 ACCAGCCCGCCCGCCGGCCCGGG + Intronic
1032091909 7:128915375-128915397 TCCAGCGGGGCCGCGAGGCTGGG + Intergenic
1034147077 7:148883625-148883647 TCCCGCCCGCCGGCGGGCCCGGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034963116 7:155374446-155374468 ACAAGCGGAGCCGCGGGCCCCGG - Intergenic
1036910537 8:12754574-12754596 GCCAGCGGCCCAGCGGCCCCGGG + Intronic
1037808214 8:22069996-22070018 TCCAGCCAGCCCGCAGCCCCAGG - Intronic
1037814836 8:22106696-22106718 TCCAGTTGGCCTGCTGGCCCGGG - Intergenic
1037815358 8:22109103-22109125 TCCCGAGGCCCGGCGGGCCCGGG + Intronic
1041829953 8:62143199-62143221 TGCAGTGTGCCCGCGAGCCCCGG - Intergenic
1044088480 8:87971257-87971279 ACCGGCCGGCCCGCCGGCCCCGG + Intergenic
1047104809 8:121720447-121720469 TGCAGCGGGGAGGCGGGCCCAGG - Intergenic
1047998458 8:130358199-130358221 TCCGGGCGGCCCGCGGCCCCGGG - Intronic
1048576040 8:135690674-135690696 CTCCGCGGGCCCGCCGGCCCCGG - Intergenic
1049102358 8:140588777-140588799 TGCAGAGGGCCCGCCAGCCCTGG - Intronic
1049340912 8:142112248-142112270 TCCTGCAGGAGCGCGGGCCCTGG + Intergenic
1057208161 9:93185275-93185297 TCCTGCGTGCCCACGGGCTCGGG - Exonic
1057337404 9:94166534-94166556 TCCAGCGGGCGGGTGGCCCCGGG + Intergenic
1057361218 9:94374987-94375009 AGCGGCGGGCTCGCGGGCCCTGG - Intronic
1057662145 9:97013177-97013199 AGCGGCGGGCTCGCGGGCCCTGG + Intronic
1059268809 9:113060114-113060136 GGCGGCGGGCCCGCGGGCCAGGG + Intergenic
1059269945 9:113065563-113065585 GGCGGCGGGCCCGCGGGCCAGGG + Intergenic
1059271079 9:113071011-113071033 GGCGGCGGGCCCGCGGGCCAGGG + Intergenic
1059272212 9:113076457-113076479 GGCGGCGGGCCCGCGGGCCAGGG + Intergenic
1059273347 9:113081899-113081921 GGCGGCGGGCCCGCGGGCCAGGG + Intergenic
1059274483 9:113087345-113087367 GGCGGCGGGCCCGCGGGCCAGGG + Intergenic
1060481225 9:124017838-124017860 TCCCGCAGCCCCTCGGGCCCGGG + Intronic
1060583109 9:124770196-124770218 TCCAGCCCGCCCCGGGGCCCCGG - Intronic
1060982738 9:127803074-127803096 GCCAGCGGGCCAGCGGGCCTGGG + Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1061129851 9:128702760-128702782 TCCCGCGGGCCAGCGGGTCTCGG + Exonic
1062141481 9:134961481-134961503 TCCAGTGGGTCAGCAGGCCCCGG + Intergenic
1062578232 9:137218339-137218361 TCCAGGGAGCCCCAGGGCCCAGG - Intergenic
1062600355 9:137316392-137316414 CCCAGCGACCCCGCGGCCCCTGG - Intronic
1062618530 9:137408812-137408834 GCCAGCGGGCGCACAGGCCCAGG + Intronic
1203468169 Un_GL000220v1:105541-105563 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1203475990 Un_GL000220v1:149513-149535 AACAGCAGGCCCGCGGGCCCCGG - Intergenic
1186463358 X:9765645-9765667 GGCCGCCGGCCCGCGGGCCCCGG - Exonic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1197607910 X:128606702-128606724 GCCGGCGGGCCCGCCAGCCCTGG + Intergenic
1199285109 X:146046419-146046441 GCCGGCGGGCCCGCAGGCCCCGG - Intergenic
1199976520 X:152897873-152897895 TCCAGCAGCCCCGCGGGGCGGGG + Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic