ID: 1140079304

View in Genome Browser
Species Human (GRCh38)
Location 16:71729632-71729654
Sequence CCACTCTCCCGAGCCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140079300_1140079304 -5 Left 1140079300 16:71729614-71729636 CCAGTTCTACAAGCAGCCCCACT 0: 2
1: 0
2: 0
3: 13
4: 130
Right 1140079304 16:71729632-71729654 CCACTCTCCCGAGCCAAAGCTGG 0: 1
1: 1
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140079304 Original CRISPR CCACTCTCCCGAGCCAAAGC TGG Intronic
900499678 1:2996292-2996314 CAACTTTCACTAGCCAAAGCTGG - Intergenic
902851229 1:19158852-19158874 CCACTGTGCCCAGCCAAAGTTGG - Intronic
904774900 1:32900799-32900821 CCACTCTCCCGAGGCCAGGAAGG - Intronic
906110288 1:43317965-43317987 CCATGCTCTCGAGCAAAAGCTGG - Exonic
906432458 1:45766080-45766102 CCACCATGCCCAGCCAAAGCAGG - Intergenic
911460404 1:98182014-98182036 CCAGTCTTCAGAGGCAAAGCAGG + Intergenic
913279436 1:117171951-117171973 TCACTCTCACGAGCTAAAGCAGG - Intronic
913611327 1:120512423-120512445 CCACTCACCCTAGACAAAGATGG + Intergenic
915849330 1:159304312-159304334 CCACTGTGCCCAGCCAATGCAGG - Intronic
917098182 1:171420670-171420692 CCACTCTCCTCAGCCTCAGCTGG + Intergenic
920401087 1:205676779-205676801 CCCCCCTCCCCAGCCCAAGCAGG + Intronic
922407638 1:225332705-225332727 CCACCATGCCCAGCCAAAGCAGG - Intronic
1065531981 10:26680088-26680110 CCACTGTCCCCAGCCACAGTGGG + Intergenic
1071498076 10:86182266-86182288 CCTCTCTCCCGGCCCCAAGCAGG + Intronic
1073990347 10:109254850-109254872 CCACTGTGCCCAGCCAAAACTGG + Intergenic
1075556190 10:123434382-123434404 CCACTCCCCCAAGCCCGAGCAGG + Intergenic
1075728785 10:124624228-124624250 CCACTCTCCACAACCAGAGCGGG + Intronic
1076099409 10:127763555-127763577 GCAACCTCCCGAGCCAAAGTAGG + Intergenic
1076732796 10:132446811-132446833 CCTTTCTCCAGAGCCACAGCAGG + Intronic
1076880711 10:133237958-133237980 CCAGTCCACGGAGCCAAAGCTGG - Exonic
1077046929 11:550894-550916 CCACTCTCCAGACCCAAGGCCGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079481308 11:20883246-20883268 CCACTATCACCAGCTAAAGCAGG - Intronic
1081245772 11:40764515-40764537 GCTCTCTCCCCAGCCAAAGGTGG - Intronic
1081670963 11:44942552-44942574 CCACTCTTCCCAGCCCCAGCAGG - Intronic
1083618175 11:64036418-64036440 CAGCTCTCCCGAGCCGAGGCTGG + Intronic
1083680102 11:64347761-64347783 CCACTGTGCCCAGCCAAGGCAGG - Intronic
1085217346 11:74844206-74844228 CCACTCCTCCAAGCCCAAGCTGG - Exonic
1089774056 11:120823883-120823905 CCACCCTCCAGGGCCAGAGCAGG + Intronic
1090390420 11:126384018-126384040 CCACTCTCCCTTCCCAATGCAGG + Intronic
1092443266 12:8527916-8527938 CCCCTCCCCCGAGCCAAGGGAGG - Intergenic
1092808646 12:12251217-12251239 CCACCGTGCCCAGCCAAAGCCGG + Intronic
1094329255 12:29273868-29273890 CCCCTCTCCCCAGCCAAGGGAGG - Intronic
1095262335 12:40110820-40110842 CAACTCTCCCTACCCAAAGGAGG - Intergenic
1095309084 12:40674750-40674772 TGAATCTCCCGAGCGAAAGCAGG + Intergenic
1098750843 12:74292367-74292389 CCAGTCCACGGAGCCAAAGCTGG - Intergenic
1100382474 12:94074466-94074488 CCTCACTACCCAGCCAAAGCGGG + Intergenic
1103411056 12:120711222-120711244 CAACGCTCCCGACCCAAAGAGGG - Intronic
1105434958 13:20368465-20368487 CCAAACTCCCGAGCCAAGGCTGG - Intergenic
1107012625 13:35683372-35683394 CCACTGTGCCCAGCCAAACCTGG + Intergenic
1112073882 13:95886753-95886775 CCACTGTGCCCAGCCAGAGCAGG - Intronic
1117204857 14:53431375-53431397 GCAGCCTCCCGAGCCAGAGCAGG + Intergenic
1117520958 14:56550919-56550941 CCACTGTCCCAACCAAAAGCAGG - Intronic
1123130438 14:105981423-105981445 CCCCTCTCCTGTCCCAAAGCAGG + Intergenic
1123580675 15:21712644-21712666 CCCCTCTCCTGTCCCAAAGCAGG + Intergenic
1123617324 15:22155267-22155289 CCCCTCTCCTGTCCCAAAGCAGG + Intergenic
1124445201 15:29724255-29724277 CCACTCTCCCCAGCCCAGCCTGG - Intronic
1124822091 15:33056342-33056364 GCAGTCTCCTGGGCCAAAGCAGG + Intronic
1125511316 15:40293949-40293971 CCTCCCTCCCTAGCCAAAGAGGG + Intronic
1129178710 15:73858093-73858115 GCAGACACCCGAGCCAAAGCTGG + Intergenic
1129701862 15:77772897-77772919 CCAGTCCCCAGAGCCGAAGCTGG - Intronic
1131432974 15:92401300-92401322 CATCTCTCCAGAGCCAAGGCTGG + Intronic
1132034227 15:98467256-98467278 ACACTCTACAGAGCCACAGCAGG - Intronic
1202989545 15_KI270727v1_random:446889-446911 CCCCTCTCCTGTCCCAAAGCAGG + Intergenic
1133225796 16:4339845-4339867 CCACTCTCCAAAGCCGCAGCGGG - Intronic
1133989887 16:10696486-10696508 CTACTCTCACCAGCCAAAGAGGG - Intergenic
1134065284 16:11224480-11224502 CCCCTCTCCCGGGCCAGGGCCGG - Intergenic
1137269002 16:46890429-46890451 CCACCCTCCTGAGCCCAGGCTGG - Intronic
1140079304 16:71729632-71729654 CCACTCTCCCGAGCCAAAGCTGG + Intronic
1143016178 17:3892434-3892456 CCTCTCGCCCCAGCCAAGGCAGG + Intronic
1144660343 17:17063970-17063992 CCACCCTCCCCAGGCAAATCTGG - Intronic
1150175683 17:63052986-63053008 ACACTCTTGCGAGCCAAATCTGG - Intronic
1153867671 18:9287841-9287863 CCACTGTGCCCAGCCACAGCTGG + Intergenic
1156651099 18:39228035-39228057 CCACTCTCTGAAGCCACAGCTGG - Intergenic
1163475750 19:17525200-17525222 CCCCACTCCCCAGCCAACGCTGG + Intronic
1165508856 19:36254260-36254282 CCACTCTACAGAGCCAGAGTGGG - Intergenic
1165631836 19:37307779-37307801 CCACTCTACAGAGCCAGAGCCGG + Intergenic
1166737335 19:45093734-45093756 CCACCCACCCGAGACAAAGATGG + Intronic
1168453200 19:56482199-56482221 CAAGTCTCCCAAGCCAAAGTTGG - Intergenic
927758011 2:25724120-25724142 CCCCTCTCCCTTGCCGAAGCTGG - Intergenic
927848447 2:26484316-26484338 CCACTCTTCCGAGGCAGGGCAGG - Intronic
929300968 2:40303366-40303388 CCACTTTCCCCAGCCAGTGCTGG - Intronic
932444260 2:71764755-71764777 CCACTCTCACTAGCCAAATCTGG + Intergenic
937770760 2:125718327-125718349 GCAATCTCCCAAGCCAGAGCAGG - Intergenic
937931419 2:127208290-127208312 CCACTCCCCCCAGCCAAGGGAGG + Intronic
938958473 2:136319988-136320010 CCACTCTTCCCCGCCCAAGCTGG - Intergenic
946546373 2:220749034-220749056 CCCCTCTCCCGAGCCAAGGAAGG + Intergenic
948945050 2:241215147-241215169 ACCCCCTCCCCAGCCAAAGCTGG - Intronic
1172548803 20:35782904-35782926 CCACTGTGCCCAGCCAAACCAGG - Intronic
1176128740 20:63487394-63487416 CCACTCTTCCCAGCCAAGGTCGG + Intergenic
1177799576 21:25814840-25814862 CCACTGTGCCCAGCCAAAGAAGG + Intergenic
1178470093 21:32884794-32884816 CCACTCTCCAGAGCAGATGCTGG + Intergenic
1181464060 22:23101410-23101432 CCACTCTCCTGAGGGAAGGCTGG - Intronic
1181519161 22:23435451-23435473 CCACTCACCCGAGTCAGGGCTGG + Intergenic
1184004377 22:41697681-41697703 CCACTCTGCGGTGGCAAAGCTGG + Exonic
1185065150 22:48628364-48628386 CCACACTCCAGAGGCAAAGGGGG - Intronic
951071231 3:18331109-18331131 CACCTTGCCCGAGCCAAAGCAGG - Intronic
951089856 3:18560005-18560027 CCCCTCTCCCCTGCCAAAACTGG + Intergenic
951334544 3:21405780-21405802 CCAGTCCACGGAGCCAAAGCTGG - Intergenic
953871751 3:46633048-46633070 CCACTCTCTGCAGCCAAGGCTGG - Intergenic
953915932 3:46921298-46921320 CCACTCTCCCCAGCCCCAGGCGG - Intergenic
958938658 3:100286282-100286304 CCATTCTCCAGAGGCAAAGCTGG - Intronic
961628870 3:128281939-128281961 TCAGGCTCCAGAGCCAAAGCAGG - Intronic
967177340 3:186873297-186873319 CCCCGATGCCGAGCCAAAGCTGG + Intergenic
970952825 4:21776162-21776184 CCCCTCTCCCCAGCCAAGGGAGG - Intronic
974499688 4:62684145-62684167 CCAGTCTCCCCAGCTACAGCAGG - Intergenic
979059710 4:116042661-116042683 CCACCATGCCCAGCCAAAGCTGG + Intergenic
979735005 4:124072723-124072745 CCCCTCTCCCCAGCCAAGGAAGG + Intergenic
982096236 4:151926064-151926086 ACACTCTCCAAAGTCAAAGCTGG + Intergenic
983417087 4:167471263-167471285 CCAGCCTCCCGAATCAAAGCAGG - Intergenic
983809681 4:172045252-172045274 CCACTGTACAAAGCCAAAGCTGG - Intronic
984432411 4:179665469-179665491 CCACTGTGCCCAGCCGAAGCAGG - Intergenic
984977354 4:185241435-185241457 CCCCGATGCCGAGCCAAAGCTGG - Intronic
985907454 5:2852040-2852062 CAACCCTCCTGAGGCAAAGCCGG - Intergenic
989601359 5:43203736-43203758 CCACTGTGCCCAGCCAAAGGAGG - Intronic
989640623 5:43579106-43579128 CCCCTCTCCCGAGCCGAAGCTGG - Intergenic
991603930 5:68381446-68381468 CAATTCTCACGAGCCAAAGGAGG + Intergenic
992248298 5:74851361-74851383 CCACCCTGGGGAGCCAAAGCAGG + Intronic
993407294 5:87527010-87527032 CCACTATGCCCAGCCAGAGCAGG + Intergenic
993878223 5:93333752-93333774 CCACTCTCACAAGGAAAAGCCGG + Intergenic
1000376596 5:160588371-160588393 CCACTATCACAAGCTAAAGCAGG - Intronic
1004306986 6:14509875-14509897 CCAGTCTCCCCAGCTAAACCTGG - Intergenic
1005201606 6:23351322-23351344 TCATTCTCCCATGCCAAAGCAGG - Intergenic
1005315555 6:24599659-24599681 GCACCCGCCAGAGCCAAAGCTGG - Intronic
1010888609 6:81275033-81275055 CAACTCTCTCAAGCTAAAGCTGG + Intergenic
1011153308 6:84299792-84299814 GCAGTCTCCCGAGCCAGAGTAGG - Intergenic
1013528648 6:110998681-110998703 CCACTCACCCGACCCCAACCAGG + Intronic
1017804531 6:157932576-157932598 CCACTGTGCCCAGCCAAATCTGG - Intronic
1018821581 6:167377982-167378004 CCACTCTCCTGGGACAAAGATGG - Exonic
1019444674 7:1065142-1065164 CCCCTCTCCAGACCCAAGGCTGG + Intronic
1019592120 7:1840875-1840897 CCACTCACCCGAGTCAGGGCTGG - Intronic
1027943961 7:84722568-84722590 CCCCTCCCCCCAGCCAAAGGAGG + Intergenic
1029163715 7:98571201-98571223 CAACTCTCCCCAGACAGAGCTGG - Intergenic
1035164079 7:156973941-156973963 CCACCCTCCCCTGCCAATGCAGG - Intergenic
1037150046 8:15626150-15626172 CCACCCTCCTGAGCCTAGGCAGG + Intronic
1039079798 8:33723013-33723035 CCAGTCCACGGAGCCAAAGCTGG + Intergenic
1039332231 8:36550669-36550691 GCAGTCTCCCGAGCCAGAGTAGG - Intergenic
1048317041 8:133370119-133370141 CCACTTTCCAGGGCCAAAGCAGG + Intergenic
1049352653 8:142172293-142172315 CCACTCTCCTGAGCCACTGTTGG + Intergenic
1049987940 9:969978-970000 CCGCTCTGCCGAGCCAAACCTGG - Intergenic
1053184509 9:36003795-36003817 CCTCTCTGCCCACCCAAAGCTGG - Intergenic
1056397116 9:86192239-86192261 CCACTGTGCCCAGCCAAGGCTGG - Intergenic
1060837877 9:126770724-126770746 CCACCCTGCCCGGCCAAAGCTGG + Intergenic
1061187557 9:129063568-129063590 CCACTTTCCCGAAGAAAAGCTGG - Exonic
1061310051 9:129756135-129756157 CCACTCTCCCTAGTCCAAGGAGG - Intergenic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061783258 9:133008067-133008089 CCACTCTTCCTAGCCACAGGTGG + Intergenic
1061819387 9:133217661-133217683 CCTCTCTCCCCACCCAAGGCAGG - Intergenic
1188037816 X:25338268-25338290 CCCCTCTCCCCAGCCAAGGGAGG - Intergenic
1190966625 X:55307426-55307448 CCACTCTCCTGAGGCTGAGCAGG - Intergenic
1191874650 X:65783804-65783826 CCACTCTCCTGAGCCAAAGCTGG + Intergenic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1194596625 X:95867497-95867519 CCCCTCCCCCAAGCCAAAGGAGG + Intergenic
1195027775 X:100895150-100895172 CCACTGTCCCCAGCCTAGGCTGG + Intergenic
1200047115 X:153409011-153409033 CCGGTCTCCCAAGCCACAGCAGG - Intergenic
1200088523 X:153623632-153623654 CAGCTCTCCAGAGCCAGAGCAGG + Intergenic
1200203451 X:154298422-154298444 CCACCTCCCCTAGCCAAAGCTGG - Intronic