ID: 1140093140

View in Genome Browser
Species Human (GRCh38)
Location 16:71853310-71853332
Sequence CTCAGACCGTGGGGTTCCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140093130_1140093140 27 Left 1140093130 16:71853260-71853282 CCCCCACCAATGTCTTAATCCCA 0: 1
1: 0
2: 0
3: 15
4: 314
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1140093135_1140093140 8 Left 1140093135 16:71853279-71853301 CCCACATTTTCTTCACAACTTTT 0: 1
1: 0
2: 6
3: 66
4: 723
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1140093136_1140093140 7 Left 1140093136 16:71853280-71853302 CCACATTTTCTTCACAACTTTTA 0: 1
1: 0
2: 7
3: 56
4: 614
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1140093132_1140093140 25 Left 1140093132 16:71853262-71853284 CCCACCAATGTCTTAATCCCACA 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1140093131_1140093140 26 Left 1140093131 16:71853261-71853283 CCCCACCAATGTCTTAATCCCAC 0: 1
1: 0
2: 2
3: 8
4: 134
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1140093129_1140093140 28 Left 1140093129 16:71853259-71853281 CCCCCCACCAATGTCTTAATCCC 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1140093133_1140093140 24 Left 1140093133 16:71853263-71853285 CCACCAATGTCTTAATCCCACAT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1140093134_1140093140 21 Left 1140093134 16:71853266-71853288 CCAATGTCTTAATCCCACATTTT 0: 1
1: 0
2: 0
3: 16
4: 289
Right 1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140093140 Original CRISPR CTCAGACCGTGGGGTTCCAC TGG Exonic
902220232 1:14959894-14959916 CTCAGGCTGTGGGGTGCCTCAGG - Intronic
902244456 1:15111108-15111130 CTCAAACTCTTGGGTTCCACAGG - Intronic
904631987 1:31849234-31849256 CCCAGGCCGTGGGGCTCCACAGG - Intergenic
914360879 1:146934955-146934977 CTCATACCGTGGAACTCCACAGG - Intergenic
915828709 1:159105349-159105371 CCCAGACCAAGGGGGTCCACGGG - Intronic
918455465 1:184707734-184707756 CTGGGACCCTGAGGTTCCACTGG - Intronic
918670959 1:187216206-187216228 CTCAGACCTTTGGGTTAGACTGG + Intergenic
922675034 1:227544553-227544575 CCCTGACCATGGGGGTCCACAGG + Intergenic
1063903289 10:10757920-10757942 CTCAAACAGTGTGGTTCCATAGG - Intergenic
1065090290 10:22225811-22225833 CTCAGAACGTGGGGATGCAGTGG + Intergenic
1070640560 10:78165922-78165944 CTCAGGCAGTGGGGTTGGACTGG + Intergenic
1077159015 11:1104186-1104208 CCCAGGCCCTTGGGTTCCACGGG + Intergenic
1083324466 11:61866360-61866382 CTCTGACCCTGGGCTTTCACGGG + Exonic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1091841035 12:3620980-3621002 CTCTGACCGTGCTGTGCCACGGG + Intronic
1092099986 12:5875147-5875169 ATCAGACACTGGGGTTCAACAGG - Intronic
1093264905 12:16991337-16991359 CTCAAGCAGTGAGGTTCCACTGG - Intergenic
1096475582 12:51907208-51907230 CTCAGGCCGTGGGGGTCCTGTGG - Intronic
1101845867 12:108362593-108362615 CTCAGGCTGTCTGGTTCCACAGG - Intergenic
1102422139 12:112812237-112812259 CTCAGACCGTGGTGTTCTGATGG - Intronic
1106276633 13:28215182-28215204 CTCAAGCAGTGTGGTTCCACTGG - Intronic
1108945674 13:56019798-56019820 CTGAGACCATGGGGTCCAACTGG + Intergenic
1109442635 13:62394956-62394978 CTCAGACCTTGGGACTCCCCAGG + Intergenic
1118896431 14:69949462-69949484 CTCAGAGCTGGGGATTCCACTGG + Intronic
1119773988 14:77237334-77237356 CTGAGACGGTGGGGATACACGGG - Intronic
1122769381 14:104091252-104091274 CTCAGACCCTGGGCATCCAGGGG - Intronic
1122821122 14:104345693-104345715 CTCATTCCAGGGGGTTCCACCGG - Intergenic
1135979233 16:27134184-27134206 CTCAAGCAGTGTGGTTCCACTGG + Intergenic
1136544228 16:30946979-30947001 CACTGGCCGTGGGGATCCACAGG - Intronic
1136686423 16:31997271-31997293 CTCAGACCTTGGGCTTCCAGGGG - Intergenic
1136787034 16:32940800-32940822 CTCAGACCTTGGGCTTCCAGGGG - Intergenic
1136882738 16:33912989-33913011 TTCAGACCTTGGGCTTCCAGGGG + Intergenic
1138898865 16:61244308-61244330 CTCAGACCTTGGGACTCCCCAGG - Intergenic
1140093140 16:71853310-71853332 CTCAGACCGTGGGGTTCCACTGG + Exonic
1142392892 16:89814404-89814426 CTCAGGCGATGGGTTTCCACTGG - Intronic
1203089273 16_KI270728v1_random:1202470-1202492 TTCAGACCTTGGGCTTCCAGGGG - Intergenic
1144754794 17:17672750-17672772 CACAGACTGTGTGGTTCCAGTGG - Intergenic
1148629428 17:49095409-49095431 CTGAGAACCTGGGGTGCCACTGG - Intergenic
1151975356 17:77481102-77481124 CCCACACAGTGGGGTTCCAGGGG - Intronic
1152645689 17:81467617-81467639 GGCCGACCTTGGGGTTCCACGGG - Intergenic
1203173720 17_GL000205v2_random:175527-175549 CTCAGACCGTGGGCTCCCGCCGG - Intergenic
1153601486 18:6784971-6784993 CTCAGACCCTGGTTGTCCACAGG - Intronic
1154501313 18:14999256-14999278 CTCATACCGTGCGGATCCCCGGG - Intergenic
1161108210 19:2455087-2455109 CTGATACCTTGGGGTCCCACGGG - Intronic
1161611233 19:5244101-5244123 ATCAGGCCGTTGGGCTCCACCGG + Exonic
1163938300 19:20470592-20470614 CACAGAGCTTGGTGTTCCACAGG + Intergenic
1166328509 19:42065638-42065660 CTCAGGCCCTGGGGCTCCTCTGG - Intronic
925598602 2:5585073-5585095 TTCAGACTTTGGAGTTCCACAGG + Intergenic
928373560 2:30758080-30758102 CCCAGCCCCAGGGGTTCCACAGG + Exonic
928814799 2:35279982-35280004 CACAGACCGTGGGGTTTCCTAGG + Intergenic
930863769 2:56103050-56103072 GTCAGAGGGTGAGGTTCCACAGG + Intergenic
935599970 2:104912782-104912804 CTCATCCCGTGGGGTCACACGGG - Intergenic
936407941 2:112224793-112224815 CTCAGACCTTAGGCATCCACTGG - Intronic
937804720 2:126125850-126125872 CTCAGACAGTGGGACTCCAGAGG + Intergenic
944918808 2:204389287-204389309 CTCTGCCTGTGGGGTTCCTCTGG - Intergenic
1174107556 20:48173438-48173460 CTAAGACTGAGGGGTTCCCCAGG - Intergenic
1175455688 20:59111798-59111820 CTAACACCATGGGCTTCCACTGG + Intergenic
1179461080 21:41535842-41535864 CTCAGACCCTGTGCTTCCTCTGG - Intergenic
1179798772 21:43800751-43800773 CCCAGCCCCTGGGGTTCCCCTGG + Intronic
1181013085 22:20053616-20053638 ATCAGGAAGTGGGGTTCCACTGG + Intronic
1183474860 22:38030623-38030645 CTCAGACCATGGCGGTCCCCTGG - Intronic
1183746650 22:39695596-39695618 CTCGGCTCGTGGGCTTCCACAGG - Intergenic
949970534 3:9399006-9399028 CCCAGACCTCTGGGTTCCACTGG + Intronic
960157126 3:114307427-114307449 CCCAAACCGTGGGGTTCCCCAGG - Intronic
963708478 3:148718443-148718465 CTCAGAGCCTGGGCTTCTACTGG + Intronic
966833018 3:184027068-184027090 CTCAAGCAGTGTGGTTCCACTGG + Intergenic
972131345 4:35838230-35838252 CTCAGTCCATGTGGTTCCCCTGG + Intergenic
979111020 4:116756807-116756829 CTCAGACCCTAGAATTCCACTGG + Intergenic
993598627 5:89891797-89891819 CTGAGAACCTGGGGTTCCAGTGG + Intergenic
994306698 5:98213905-98213927 CTCAGAACGTGGGGATCCTGTGG + Intergenic
994843237 5:104952129-104952151 CTAAGACTGTGGAGTTCCAGGGG - Intergenic
998407818 5:141883724-141883746 CTCCGAACGTGGGGATCCATCGG + Intergenic
999596371 5:153209820-153209842 CTCTGACCATGAGGTTCCATGGG + Intergenic
1001746918 5:174099295-174099317 CTCAGGCCGGCGAGTTCCACTGG - Intronic
1002369831 5:178742678-178742700 CACAGAGCTTGGTGTTCCACAGG + Intergenic
1002491257 5:179579147-179579169 CTCAGACCGTGAGAGTCCTCAGG - Intronic
1002643029 5:180639645-180639667 GTCAGACCCTGTTGTTCCACTGG + Intronic
1003290142 6:4773711-4773733 CTCTGACAGTTGGCTTCCACTGG - Intronic
1006079667 6:31558133-31558155 CTCAGCACGTGGGGGTCGACGGG - Exonic
1011284095 6:85705672-85705694 CTCAGACCTAGGGGCTCCCCAGG - Intergenic
1019642917 7:2114307-2114329 CTCAGACCGTGGGCTGGCTCAGG - Intronic
1029417843 7:100454655-100454677 CTCCGCCCGTGGGGTTCAAGTGG - Intergenic
1029614525 7:101647960-101647982 CACACAGCCTGGGGTTCCACTGG - Intergenic
1033779050 7:144647885-144647907 CTCAAACAGCGTGGTTCCACTGG + Intronic
1034294212 7:149957572-149957594 CTAAGAACCTGGGGTGCCACTGG - Intergenic
1034571256 7:151958433-151958455 CTCAGACCTTGGGACTCCCCAGG - Intronic
1034811857 7:154139300-154139322 CTAAGAACTTGGGGTGCCACTGG + Intronic
1035118011 7:156540984-156541006 ACCAGCCCCTGGGGTTCCACTGG + Intergenic
1035556949 8:574400-574422 CTCAGTGGCTGGGGTTCCACTGG - Intergenic
1040786825 8:51176417-51176439 CTCAGACCTTGGGAATCCCCAGG - Intergenic
1048370374 8:133771644-133771666 GGCAGCCCGTGGGGCTCCACAGG + Intergenic
1051500009 9:17766099-17766121 CTAAGACTGTGAGGTTCCAGAGG - Intronic
1052430566 9:28361094-28361116 CACAGACAGTGTGGATCCACTGG - Intronic
1052558257 9:30048767-30048789 CTCAGACCTTGGGACTCCTCAGG - Intergenic
1057939480 9:99268711-99268733 CTCAGACGGTGGGATTACAGGGG + Intergenic
1061771103 9:132922593-132922615 CTGTGGCCGTGGGTTTCCACAGG - Intronic
1061779090 9:132985180-132985202 CTCAGCCTGTGAGGTTCCCCCGG - Intronic
1062200050 9:135297846-135297868 CTAAGACCACGGGGTCCCACCGG + Intergenic
1187426890 X:19185935-19185957 CCCAGACCGTGTGGTTCCTGAGG - Intergenic
1193211375 X:78810707-78810729 CCCAGACCTAGGGGTTCCCCAGG - Intergenic
1197748654 X:129950315-129950337 CCCAGAACGTGGGGTCCCAAAGG - Intergenic
1202600985 Y:26592763-26592785 CACAGAACCTGGTGTTCCACAGG + Intergenic