ID: 1140095062

View in Genome Browser
Species Human (GRCh38)
Location 16:71868070-71868092
Sequence CAGCTGGGCAGCATATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140095054_1140095062 12 Left 1140095054 16:71868035-71868057 CCCCTGGTGGTCACAAGGAAAAA 0: 1
1: 0
2: 3
3: 18
4: 226
Right 1140095062 16:71868070-71868092 CAGCTGGGCAGCATATCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 161
1140095050_1140095062 28 Left 1140095050 16:71868019-71868041 CCAGCAAATACTTGATCCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1140095062 16:71868070-71868092 CAGCTGGGCAGCATATCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 161
1140095056_1140095062 10 Left 1140095056 16:71868037-71868059 CCTGGTGGTCACAAGGAAAAATA 0: 1
1: 0
2: 0
3: 21
4: 240
Right 1140095062 16:71868070-71868092 CAGCTGGGCAGCATATCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 161
1140095055_1140095062 11 Left 1140095055 16:71868036-71868058 CCCTGGTGGTCACAAGGAAAAAT 0: 1
1: 0
2: 1
3: 28
4: 274
Right 1140095062 16:71868070-71868092 CAGCTGGGCAGCATATCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 161
1140095049_1140095062 29 Left 1140095049 16:71868018-71868040 CCCAGCAAATACTTGATCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1140095062 16:71868070-71868092 CAGCTGGGCAGCATATCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140095062 Original CRISPR CAGCTGGGCAGCATATCCCC AGG Intronic