ID: 1140098664

View in Genome Browser
Species Human (GRCh38)
Location 16:71895885-71895907
Sequence CCCCGAGGTGTGTCTTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140098651_1140098664 27 Left 1140098651 16:71895835-71895857 CCTCTGGTCCTGGATCCTCGAAG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098653_1140098664 12 Left 1140098653 16:71895850-71895872 CCTCGAAGCCCCTTAACTTTCCC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098660_1140098664 -10 Left 1140098660 16:71895872-71895894 CCTAGTCTTCCTGCCCCGAGGTG 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098657_1140098664 -8 Left 1140098657 16:71895870-71895892 CCCCTAGTCTTCCTGCCCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098656_1140098664 2 Left 1140098656 16:71895860-71895882 CCTTAACTTTCCCCTAGTCTTCC 0: 1
1: 0
2: 2
3: 25
4: 250
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098654_1140098664 4 Left 1140098654 16:71895858-71895880 CCCCTTAACTTTCCCCTAGTCTT 0: 1
1: 0
2: 0
3: 14
4: 248
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098659_1140098664 -9 Left 1140098659 16:71895871-71895893 CCCTAGTCTTCCTGCCCCGAGGT 0: 1
1: 0
2: 1
3: 6
4: 119
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098652_1140098664 19 Left 1140098652 16:71895843-71895865 CCTGGATCCTCGAAGCCCCTTAA 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
1140098655_1140098664 3 Left 1140098655 16:71895859-71895881 CCCTTAACTTTCCCCTAGTCTTC 0: 1
1: 1
2: 1
3: 16
4: 264
Right 1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140098664 Original CRISPR CCCCGAGGTGTGTCTTCCTT GGG Intronic
900397648 1:2459728-2459750 GCCTGTGGTCTGTCTTCCTTGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
912967449 1:114248767-114248789 CCCTGAGGTGCCTCTTCCTCTGG + Intergenic
913723246 1:121622877-121622899 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913723720 1:121628743-121628765 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913723923 1:121631286-121631308 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913724085 1:121633152-121633174 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913724249 1:121635021-121635043 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913724416 1:121636890-121636912 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913724580 1:121638759-121638781 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913724747 1:121640628-121640650 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913724908 1:121642497-121642519 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913725073 1:121644366-121644388 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913740318 1:121835998-121836020 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913740639 1:121839998-121840020 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913740842 1:121842540-121842562 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913741173 1:121846448-121846470 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913741335 1:121848317-121848339 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913741500 1:121850186-121850208 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913744012 1:121881269-121881291 TCCCGAGTTGAGCCTTCCTTTGG - Intergenic
913749022 1:121940818-121940840 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913751431 1:121971989-121972011 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913752835 1:122038370-122038392 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913753986 1:122051774-122051796 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913755257 1:122066790-122066812 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913757687 1:122094953-122094975 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913759048 1:122110683-122110705 TCCAGAGGTGAGCCTTCCTTTGG + Intergenic
913760156 1:122123751-122123773 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913760536 1:122127821-122127843 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913761666 1:122140883-122140905 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913762954 1:122155812-122155834 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913763116 1:122157677-122157699 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913763284 1:122159543-122159565 TCCAGAGGTGAGCCTTCCTTTGG + Intergenic
913764745 1:122176547-122176569 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913766958 1:122202332-122202354 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913767277 1:122206071-122206093 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913768071 1:122215404-122215426 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
913768243 1:122217272-122217294 TCCCGAGTTGAGCCTTCCTTTGG + Intergenic
915225429 1:154407717-154407739 CCCAGAGGTTTGTTTTCCTCGGG + Intronic
917959200 1:180128936-180128958 TCCCCAGGCCTGTCTTCCTTTGG - Intergenic
921545162 1:216465684-216465706 CCCCTAGGTGTAGCCTCCTTAGG - Intergenic
924286433 1:242492764-242492786 CCAGGATGTGTGTCTTCCTCAGG - Intronic
924601830 1:245497636-245497658 CCCTGAAGTGTGTATTCCTAAGG + Intronic
924622594 1:245675091-245675113 GCCCCATGTGTCTCTTCCTTTGG - Intronic
1072104885 10:92264512-92264534 CCTTCAGGTGTTTCTTCCTTTGG + Intronic
1073423711 10:103443558-103443580 ACCCCTGGTGTGTCTGCCTTGGG + Intronic
1073515671 10:104073733-104073755 CCCCAAGCTGTGTCTTCACTTGG - Intronic
1074567903 10:114597888-114597910 CCTCGAGGTGTGCATTCCTGTGG - Intronic
1077466928 11:2737913-2737935 CCCCCAGGTGTGCCTCCCCTGGG - Intronic
1077810442 11:5631140-5631162 CCCAAAGGTGTGTATTCGTTGGG - Intronic
1080599657 11:33809428-33809450 CCCCCAGGGGTGTCTTTCTAAGG - Intergenic
1084328438 11:68415273-68415295 CCTCGAGGAGTGTCTTCTCTCGG + Intronic
1088537319 11:110875435-110875457 CCCTGAGGTGTGCCTTTCTGAGG + Intergenic
1091862970 12:3803491-3803513 CCCCAAGTTTTGTCTTCCTTGGG - Intronic
1096569257 12:52511469-52511491 AACCGAGGTGTTCCTTCCTTTGG + Intergenic
1098156845 12:67608352-67608374 CCCCTAGGTTTGTCTTACTAAGG - Intergenic
1101878937 12:108613556-108613578 CCAGGAGGTGTGGCTTCCTTGGG + Intergenic
1103121739 12:118385985-118386007 TGCTGAGGTGTGTCTTCCTTTGG + Intronic
1106845946 13:33737924-33737946 CCCCGTGGTGGATTTTCCTTAGG - Intergenic
1108108923 13:47046456-47046478 GCCAGAGCTCTGTCTTCCTTTGG + Intergenic
1111740867 13:92204698-92204720 GCCCTATGTGTTTCTTCCTTTGG - Intronic
1114736495 14:25049042-25049064 CCCCGGGGTGTATCTGCCCTTGG - Intronic
1117754015 14:58955334-58955356 CCCAGAGGAGTGACCTCCTTCGG + Intergenic
1118188974 14:63563361-63563383 CCACCAGGTATATCTTCCTTAGG + Intergenic
1119078633 14:71671135-71671157 TCCAGAGATGTGCCTTCCTTTGG + Exonic
1119860682 14:77933822-77933844 CGCTGAGGTGTGACTTCCTCTGG - Exonic
1120412484 14:84175173-84175195 GCCCTAGGTGTGACCTCCTTAGG + Intergenic
1120655188 14:87180864-87180886 GACCTAGGTGTCTCTTCCTTTGG - Intergenic
1122355809 14:101122269-101122291 CCCCGATGTGTGGCCTCCTGGGG + Intergenic
1128904155 15:71452356-71452378 CCCCCAGGTGTTTCTACCCTGGG + Intronic
1129390416 15:75217472-75217494 GCCCCAGGTCTGTCTTCCCTTGG + Intergenic
1129732097 15:77938489-77938511 GCCCCAGGTCTGTCTTCCTTTGG - Intergenic
1131390809 15:92046815-92046837 CACCTAGGTCTGTCTTCTTTAGG + Intronic
1139777379 16:69324865-69324887 TCCAGGGCTGTGTCTTCCTTGGG + Exonic
1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG + Intronic
1141853482 16:86664741-86664763 CCCCAAGGTGTGTCTGTCGTGGG - Intergenic
1144850575 17:18242061-18242083 CCCCGAGATCTGCCTTCCCTGGG + Intronic
1147969359 17:44211274-44211296 CCTCGAGGTGAGTGTTCCTCCGG - Exonic
1148462632 17:47847225-47847247 CCCCCAGGTCTGACGTCCTTGGG - Exonic
1151584848 17:75002874-75002896 CCGTGGGGTGTGTCTTCTTTGGG - Intronic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1155910313 18:31498109-31498131 CCCCGAGGGCTGTCTTCCCGTGG - Exonic
1158107738 18:53904728-53904750 CCAAGAGGTGTGCCTTCCTCGGG - Intergenic
1161154906 19:2727520-2727542 CCCTGAGCTGTGTCTGCTTTTGG - Intronic
1162068250 19:8138418-8138440 CCCTGAGCTGTGTCCTCCTCGGG - Exonic
1162440342 19:10688495-10688517 GCCCAAGGTGTGTCTTTCCTGGG + Intronic
1164608515 19:29616887-29616909 CCTCGAAGTCTGTCTTCCTGTGG - Intronic
1168101180 19:54141919-54141941 CCCTAAGGTATGTCTTCCCTTGG + Exonic
926406950 2:12563594-12563616 CTCCAAGGTGTATCTTTCTTAGG - Intergenic
928436767 2:31259585-31259607 CCACAAGGGGTTTCTTCCTTAGG - Intronic
929533567 2:42767079-42767101 CCCCCAGGTGTGCGTTCCTCAGG + Exonic
937076946 2:119113988-119114010 CCTCCAGGTCTGGCTTCCTTTGG + Intergenic
937252251 2:120532301-120532323 GACCGAGATGTGTCTCCCTTTGG - Intergenic
937281393 2:120719723-120719745 CCCCACGGTGTGCCTTCCCTGGG - Intergenic
939510159 2:143095072-143095094 GCCCTAGGTGTGACTGCCTTAGG - Intronic
946695281 2:222350832-222350854 ACCAGAGGTGTGGTTTCCTTGGG - Intergenic
1169248707 20:4044371-4044393 CCTCTAAGTGTGTCTTCCTGTGG + Intergenic
1170586827 20:17741165-17741187 TTGAGAGGTGTGTCTTCCTTTGG + Intergenic
1171091063 20:22286136-22286158 CCCTGAGGCGTGTCTTTCTCAGG - Intergenic
1172660090 20:36562054-36562076 CCCTGAGGTGGGTATACCTTGGG - Intergenic
1173852921 20:46230064-46230086 CCCAGAGGAATGGCTTCCTTGGG + Intronic
1176517161 21:7794418-7794440 CCCTCAGGTGTGTCACCCTTGGG - Intergenic
1178018382 21:28378798-28378820 TCCTGATGTGTGTCCTCCTTTGG - Intergenic
1178323346 21:31623082-31623104 GCCCTATGTGTGTCTTCCCTTGG - Intergenic
1178651189 21:34424430-34424452 CCCTCAGGTGTGTCACCCTTGGG - Intergenic
1181019592 22:20092349-20092371 CCACCAGCTCTGTCTTCCTTGGG + Intronic
954222152 3:49161507-49161529 CCCCTGGGTGTGTCCTCCCTTGG - Intergenic
955074224 3:55597956-55597978 TCCCAAGGTGTGGCTTCTTTTGG - Intronic
961445723 3:126980418-126980440 CCTTGAGGAGTGTCTGCCTTGGG + Intergenic
961965580 3:130898756-130898778 CCCCTAGGGGTGTGTTCCCTAGG - Intronic
964320737 3:155494322-155494344 CAGCTAGGTGTGTATTCCTTGGG - Exonic
964439858 3:156696637-156696659 CCAAGAGTTGTTTCTTCCTTTGG + Intronic
967191863 3:186991639-186991661 CCTGGAGGTGTGTGTTCCTGTGG + Intronic
967766990 3:193291851-193291873 ACCCTAGGTGTCTCTTCCTTTGG + Intronic
969449715 4:7266089-7266111 GCCCGAGGTGTTTCTTGCCTGGG + Intronic
972633345 4:40860529-40860551 GTCCTATGTGTGTCTTCCTTGGG + Intronic
976325249 4:83763690-83763712 GCCCTATGTGTCTCTTCCTTTGG + Intergenic
981005584 4:139871686-139871708 CCCTGAGCTGTGTCTTCCTCAGG + Intronic
982070916 4:151693624-151693646 CCCCTAGTTCTGTGTTCCTTGGG - Intronic
984569451 4:181374358-181374380 CCATGAGGTTTCTCTTCCTTAGG - Intergenic
990918476 5:60936812-60936834 CCCTAAGGTGTGTGATCCTTTGG + Intronic
992572781 5:78076879-78076901 GCCCTAGGTGTGTCTTCGTTTGG + Intronic
992969873 5:82045459-82045481 CCCTAAGGTGTGTATGCCTTTGG + Intronic
994357045 5:98804708-98804730 CACCTGGGTGGGTCTTCCTTGGG + Intergenic
996818018 5:127595075-127595097 CTACGAGCTGTGGCTTCCTTGGG + Intergenic
997236185 5:132273091-132273113 CCTCGTGGTGTGTTTGCCTTGGG + Exonic
998833796 5:146185078-146185100 CCCAGATGTGTGTCTACCTAAGG + Intergenic
1001246832 5:170111276-170111298 CCCCGAGGTGGGTCTGCAATGGG + Intergenic
1005796996 6:29374861-29374883 CCCCCAGGTGTGTATTCTGTTGG - Exonic
1007352612 6:41284769-41284791 CCCTGAGTTGAGTCTTCCTAAGG - Intronic
1009460812 6:63910519-63910541 CCCCTAGTTGTCTTTTCCTTTGG + Intronic
1010712471 6:79191375-79191397 GCCCTATGTGTCTCTTCCTTTGG - Intergenic
1010833223 6:80555984-80556006 CCCCAGGGTGTGTCTACATTGGG + Intergenic
1011175280 6:84552757-84552779 ACCCGAGTGGTGTCTTCCATAGG - Intergenic
1011662422 6:89605985-89606007 CCCACCTGTGTGTCTTCCTTAGG + Exonic
1012976113 6:105782762-105782784 CTCCCAGGTCTGTCTTCCTCTGG - Intergenic
1014049940 6:116940261-116940283 CTTCTAGGTGAGTCTTCCTTTGG - Intergenic
1015489598 6:133810907-133810929 TCCCTATGTGTCTCTTCCTTTGG + Intergenic
1019058352 6:169238779-169238801 CCCAGAGCTGTGTCATCCTCAGG - Intronic
1021667546 7:23000834-23000856 CTCCGAGGTCTGTCTTCATGTGG - Intronic
1034850646 7:154490291-154490313 CCCCCAGGTGTCTCTTCCCCCGG + Intronic
1037907647 8:22724842-22724864 CCTCGAGTTTTGTTTTCCTTGGG + Exonic
1049456426 8:142693339-142693361 CCCAGAGGTGTGGGATCCTTTGG - Intergenic
1049678304 8:143903270-143903292 CCCAGGGGTGTGGCTTCCTCGGG + Intergenic
1051310235 9:15763142-15763164 ACCCTATGTGTCTCTTCCTTTGG - Intronic
1057598406 9:96436463-96436485 GCTTGAGGTGTCTCTTCCTTTGG - Intergenic
1060652675 9:125342893-125342915 CCCCCAGCTGTATTTTCCTTGGG - Intronic
1060960254 9:127675782-127675804 CAATGAGGTGTGTTTTCCTTAGG + Exonic
1188450307 X:30301807-30301829 CCCAGAAGTGTGTCTTCATTTGG - Intergenic
1193910563 X:87301202-87301224 GCCCGATGTGTCTCTTACTTTGG - Intergenic