ID: 1140107379

View in Genome Browser
Species Human (GRCh38)
Location 16:71973176-71973198
Sequence CTGGGCAAAAGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 978
Summary {0: 1, 1: 0, 2: 3, 3: 106, 4: 868}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140107379_1140107389 17 Left 1140107379 16:71973176-71973198 CCCTCCTCCCTCCTTTTGCCCAG 0: 1
1: 0
2: 3
3: 106
4: 868
Right 1140107389 16:71973216-71973238 CACCTGATTATTTTTCTTTCTGG 0: 1
1: 0
2: 1
3: 47
4: 438
1140107379_1140107390 18 Left 1140107379 16:71973176-71973198 CCCTCCTCCCTCCTTTTGCCCAG 0: 1
1: 0
2: 3
3: 106
4: 868
Right 1140107390 16:71973217-71973239 ACCTGATTATTTTTCTTTCTGGG 0: 1
1: 0
2: 4
3: 67
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140107379 Original CRISPR CTGGGCAAAAGGAGGGAGGA GGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900149107 1:1170565-1170587 CTGAGCAAAAGAAGGAGGGAGGG - Intergenic
900284654 1:1893333-1893355 CTGGGCCAAAGCCTGGAGGATGG - Intergenic
900507338 1:3036333-3036355 CTGGGCACATGGAGTGAGGCAGG + Intergenic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
901122382 1:6906205-6906227 CCTGGCAAGATGAGGGAGGAGGG + Intronic
901281638 1:8040914-8040936 CTAGGAAAATGGAGTGAGGAAGG - Intergenic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901659755 1:10791347-10791369 CTGGGAAAAAGAAGGGAGGTGGG + Intronic
901737541 1:11321994-11322016 CTCAGCAGAAGGATGGAGGATGG - Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901908775 1:12437361-12437383 CAGGACGAAAGGAGGGAGGGGGG + Intronic
902514740 1:16984008-16984030 CTTGAAAAAAGGAGGGAGGTTGG + Intergenic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904446125 1:30574252-30574274 CTGGGCCAAAGGAGGCAGGAAGG - Intergenic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904911355 1:33936674-33936696 CTGGCAATAAGGAGGGAGGGAGG + Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905245540 1:36610653-36610675 CTGGGCAGAGGGAGGGAAAAAGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905773757 1:40654937-40654959 CTGGGCACCAGGAGGATGGAGGG - Intronic
905811562 1:40917030-40917052 CTGGGCAGGAGGGTGGAGGATGG + Intergenic
906562586 1:46770136-46770158 CTTGGCAAATGGAAGGAGAAGGG - Intronic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906711103 1:47930521-47930543 CAGGGCAGTAGCAGGGAGGAGGG - Intronic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
907048363 1:51313663-51313685 CTGGGCAAAGGCCTGGAGGAGGG - Intronic
907222854 1:52920292-52920314 GTGGGCAACAGCAGGGAGCAAGG + Intronic
907707346 1:56844345-56844367 GAGGCCAAAAGGAGGCAGGAGGG - Intergenic
907903740 1:58765240-58765262 CTAGGCAGCAGGATGGAGGAAGG + Intergenic
908378518 1:63572013-63572035 CTGGGCAAGTGAAGGGAGAAAGG + Intronic
909070566 1:70988531-70988553 CTGGTCAGTAGGAAGGAGGAAGG - Intronic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
909533348 1:76706212-76706234 CAGGAAGAAAGGAGGGAGGAAGG - Intergenic
910410385 1:86937251-86937273 CTGGAAGGAAGGAGGGAGGAAGG - Intronic
910416790 1:87009685-87009707 CTAGGCTAAAGGAGAGAGGAAGG + Intronic
910730724 1:90392937-90392959 TTGGGCAAGAGGAGAGTGGAGGG - Intergenic
910736295 1:90461592-90461614 GAGGGCAGAGGGAGGGAGGAGGG - Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912522013 1:110252024-110252046 AGGGGCTAAAGGAGGGAGCAAGG + Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
914245729 1:145884800-145884822 CTGGGGAAAAGCAGGCAGAAAGG + Intronic
914425877 1:147575386-147575408 CTGGGCAAAAGCAGTGAACAAGG - Intronic
915583492 1:156830433-156830455 CTGGGCACAAGGGTGGAGGAGGG - Intronic
915725501 1:158014208-158014230 GAGAGAAAAAGGAGGGAGGAGGG + Intronic
916212223 1:162368251-162368273 CTGGGCTACAGGCAGGAGGAAGG - Exonic
916447012 1:164881645-164881667 GTGGGGAAAAAGAGGAAGGAAGG + Intronic
916982181 1:170150165-170150187 CTAGGCAGTTGGAGGGAGGAAGG - Intronic
917680273 1:177358824-177358846 AGGGGGAAAAGGAGGAAGGAAGG + Intergenic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918918201 1:190671588-190671610 CTGGGAAAGAGGAGGCAGGGTGG + Intergenic
919061616 1:192641360-192641382 AGGGGAAAAGGGAGGGAGGAAGG + Intronic
920004768 1:202825063-202825085 GTGGGAAATAAGAGGGAGGAAGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920363000 1:205432184-205432206 GAAGGGAAAAGGAGGGAGGAGGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921571489 1:216784719-216784741 TGGGGCAAAAGGGAGGAGGAAGG - Intronic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922412696 1:225391550-225391572 GTGGGCAGAAGCAGGGAGTAGGG + Intronic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922912916 1:229232524-229232546 CTAGGCAACAGGATGGAGGATGG + Intergenic
922930357 1:229384190-229384212 CTAGCCAGAAGGAAGGAGGAAGG - Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
922991325 1:229914815-229914837 GTGGGCAAAGGGTGGGAGCAGGG - Intergenic
923268472 1:232334599-232334621 AGGGGCAAAAGGGAGGAGGAAGG - Intergenic
923850824 1:237792515-237792537 TGGGGCAAATGGAGGAAGGATGG + Intronic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
924455008 1:244212366-244212388 CTGGGCAATGGGAGGGAGCAGGG + Intergenic
924519500 1:244794088-244794110 TTGGGAAGAAGGAGGGAAGAGGG - Intergenic
924710433 1:246526618-246526640 ATGGGGCAAAGGAGGGAGCATGG + Intergenic
924861271 1:247925079-247925101 CTGGACACCATGAGGGAGGAAGG + Intergenic
1062931731 10:1357340-1357362 CTGAGAAAAATGAGGGAGGTTGG + Intronic
1064011181 10:11737784-11737806 GTGAGCAGAGGGAGGGAGGATGG - Intergenic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064453506 10:15465443-15465465 CTGGGAAGAAGCAGGGAGGCAGG - Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065966204 10:30772644-30772666 CCAGGCAACAGGAAGGAGGAAGG - Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067415314 10:46097877-46097899 CTGGGAAACTGGAGGGAGGTAGG - Intergenic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067832778 10:49620010-49620032 CAGGGCAGAAGGAGAGATGAGGG + Intronic
1068041573 10:51831701-51831723 CTGGCCAGTAGGATGGAGGAAGG + Intronic
1068297884 10:55098565-55098587 CTTGGCAAATAGAGGGAAGATGG - Intronic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1068819166 10:61353125-61353147 CTGGATAAAAGTGGGGAGGAAGG - Intergenic
1069633199 10:69910127-69910149 ATGGGCAATAGAAGGGAGGTAGG - Intronic
1069882887 10:71604643-71604665 CTGAGCAAAAGGGTGGAGGTGGG - Intronic
1069887938 10:71635627-71635649 CAGGGCAAGAGGGGGAAGGAGGG + Intronic
1070324412 10:75378517-75378539 CTGGGCTGAGGGAGGGAGGGAGG - Intergenic
1070489646 10:76964606-76964628 CTGGGCAAAAGAAAGAAGGAAGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070589900 10:77794289-77794311 CTGGGCAGATGGGGGAAGGAGGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1071058366 10:81538541-81538563 GTGAGCAAAATGATGGAGGAAGG - Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072735373 10:97875607-97875629 CTGGGCACAGGGAGGCAGGGAGG + Intronic
1073071711 10:100798578-100798600 ATAGGAAAAAGGAGAGAGGAGGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073458841 10:103653911-103653933 CTGGGCAGCAGGAGGTGGGAGGG - Intronic
1073610096 10:104934691-104934713 CTGAGCATAAGGAGGCAGGCTGG - Intronic
1073759827 10:106617280-106617302 GGAGGCAGAAGGAGGGAGGAAGG - Intronic
1073911221 10:108347054-108347076 GAGGGAAAGAGGAGGGAGGAAGG + Intergenic
1074436409 10:113438114-113438136 TTAGGCTCAAGGAGGGAGGAAGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074868128 10:117556702-117556724 CTGGACAAAAGGATGGGTGACGG - Intergenic
1075424083 10:122328019-122328041 CTGGGCAAGGCTAGGGAGGACGG + Intronic
1075448692 10:122531942-122531964 GTTGGCAAGAGGGGGGAGGAAGG + Intergenic
1075695971 10:124435550-124435572 ATGTGCAAAAGAAGAGAGGATGG + Intergenic
1075714102 10:124546016-124546038 CTTGGCAGAGGGAGGGAGGGAGG - Intronic
1075887423 10:125913383-125913405 TCGGCCAAAAGGAGGAAGGAGGG + Intronic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076141229 10:128079893-128079915 CTGGGCAAGACCCGGGAGGAGGG + Intronic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076697333 10:132253301-132253323 CCGGGCAAAAGGAAGCTGGAGGG + Intronic
1076729175 10:132429732-132429754 ATGGGCCACAGGAGGAAGGAAGG - Intergenic
1076778186 10:132709599-132709621 CTGGGCCACAGGCTGGAGGAGGG + Intronic
1076890278 10:133280017-133280039 CTGGGCAGCAGGGGTGAGGAAGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077412172 11:2408700-2408722 CGGGGCAGGAGGAGGGAGGAGGG + Intronic
1077491639 11:2863339-2863361 CTGGGCAGAGTGAGGGAGGGAGG + Intergenic
1077555566 11:3224440-3224462 CTGGGAGGAAGGAGGGAGGGAGG - Intergenic
1078064977 11:8072321-8072343 CTAGGCTCTAGGAGGGAGGAAGG - Intronic
1078449234 11:11428057-11428079 CTGGGCTAACGGAAGGAAGAGGG - Intronic
1078549756 11:12272034-12272056 CTGGGCTCCAGGAGGGTGGAGGG - Intergenic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080123471 11:28704044-28704066 CTGGAAAAAAGGAGGAAGGAAGG - Intergenic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1080539943 11:33256491-33256513 CTAGGGAAAAGGAGGAAAGATGG + Intergenic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1081626441 11:44658808-44658830 CTGAGCAGAGGGAGGGAGGAGGG + Intergenic
1081654826 11:44850295-44850317 CTTGGCAAATGGTGGCAGGAGGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081781090 11:45713376-45713398 GAGGGCAAAAGGAGGTGGGAGGG - Intergenic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082693542 11:56332429-56332451 CTGGGCACGACGAGGGTGGAGGG - Intergenic
1082780903 11:57286876-57286898 CTGGGCAGAAGGGCAGAGGAGGG - Intergenic
1082868914 11:57925493-57925515 CAGGGCAACAGGTGGAAGGAGGG - Intergenic
1083206147 11:61150490-61150512 CTGGGCAAATGGGCAGAGGAGGG - Intronic
1083212364 11:61196012-61196034 GGGGGCAGATGGAGGGAGGATGG - Intergenic
1083306524 11:61764736-61764758 TTGGGCATCATGAGGGAGGACGG - Intronic
1083369475 11:62166836-62166858 ATGGGAAACAGGAGGCAGGAGGG + Intergenic
1083495457 11:63048005-63048027 GTGGGCAAAGGCATGGAGGAGGG + Intergenic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084225147 11:67711058-67711080 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
1084262967 11:67990901-67990923 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
1084457113 11:69274245-69274267 CTGGGCACCAGGTGGGTGGATGG + Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084748417 11:71188284-71188306 CTGGGCAGATGGGGGTAGGATGG - Intronic
1084810426 11:71608215-71608237 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085261285 11:75206167-75206189 CTGGGAAACAAGAGGGATGAAGG - Exonic
1085457591 11:76674066-76674088 CTGGGCAGAAGCAGGGAGTGAGG - Intergenic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1085677731 11:78540563-78540585 CTGGGTAAAAGGTGGGGGTAGGG - Intronic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086052003 11:82603314-82603336 CTGGCCCAAACGAGTGAGGAAGG + Intergenic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086404105 11:86485679-86485701 CTGGGTAAAAGGGGAGAGAATGG - Intronic
1086417889 11:86607357-86607379 GTGGGAAAAGGGAGGGAGAAAGG - Intronic
1086472084 11:87124792-87124814 AGGGGAAAAAGGAGGGAGGAAGG - Intronic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1087328363 11:96751015-96751037 GAGGGCAAGAGGTGGGAGGAGGG - Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088579269 11:111299759-111299781 CGGGGGCGAAGGAGGGAGGAGGG + Intronic
1088862433 11:113814355-113814377 CTAGACAAAAGGAGACAGGAAGG + Intronic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089169020 11:116499745-116499767 GTGCGCACAGGGAGGGAGGATGG - Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089441902 11:118524582-118524604 ATGGGCAAAAGGAGGAAGGGAGG - Exonic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090265809 11:125352121-125352143 CTGGTCTAAAGGATGTAGGAGGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090501217 11:127263241-127263263 CTGGGCAAAGGGCAGAAGGAGGG + Intergenic
1090807277 11:130210392-130210414 GTAGGAAAAAGGAGGAAGGAGGG - Intergenic
1091004399 11:131939547-131939569 CTGTGCAGATGGAGGGAGTATGG + Intronic
1091021514 11:132104334-132104356 GGGGGAAAATGGAGGGAGGAAGG - Intronic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091454946 12:599944-599966 CTGGGCAGAAGGAGGCGGGCTGG - Intronic
1091693384 12:2611831-2611853 CTGGGCAAAAGGTGGGGAGGAGG + Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1091934794 12:4426573-4426595 CCGGGTGAAAGCAGGGAGGAGGG + Intergenic
1092125782 12:6074133-6074155 ATGGGGAAAAGGAGGAGGGATGG - Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093111791 12:15161467-15161489 ATGGGAAGAAGGAGGAAGGAAGG - Intronic
1093284467 12:17241422-17241444 CTGGGAAAAGGGTGGGAGGGGGG - Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093477806 12:19574251-19574273 GGGGGCAACAGGAGAGAGGATGG + Intronic
1094703088 12:32889139-32889161 CTGGGCAAGAGAAGGAAGGGAGG + Intronic
1095123402 12:38445048-38445070 CTGCGCAAAAGGAGGAAGCTGGG - Intergenic
1095713443 12:45315398-45315420 CTGGGCAGAAGCAGGGAATATGG + Intronic
1095875096 12:47071413-47071435 CCAGACAAAAGGAGGCAGGAGGG + Intergenic
1096199075 12:49668439-49668461 TTGGGAAAGAGGAGGGAGGTAGG - Intronic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096694204 12:53338519-53338541 AAGGGGAAAAGGAGGAAGGATGG + Intronic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1096976992 12:55705121-55705143 GAGGCCAAAAGTAGGGAGGAGGG + Intronic
1097070984 12:56354773-56354795 CTGGACAAAAGGAGAAAGGTGGG - Exonic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1097474781 12:60039675-60039697 CTAGGCAAAAAGAGGATGGATGG + Intergenic
1098384679 12:69906404-69906426 CTGAGCAAAACTAGGGGGGAAGG + Intronic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100263039 12:92950595-92950617 CTGGGCAACAAGAGCCAGGAAGG + Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100759817 12:97794907-97794929 CTGGGCAAAAGGCAGGGAGAGGG - Intergenic
1100909340 12:99339752-99339774 CAAGGCAGAAGTAGGGAGGATGG - Intronic
1100985563 12:100199427-100199449 CTTGGAGAAAGGAGGGTGGATGG + Intronic
1101915462 12:108892539-108892561 CCGGGCATGAGGAGGGAGGTGGG - Intronic
1102052800 12:109875293-109875315 ACAGGCAAAAGGAGGGAGGTGGG + Intronic
1102252209 12:111394950-111394972 CTGGGCAACAGGATGGGAGATGG + Intergenic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102491673 12:113293090-113293112 CTGGTCCGAAGGAGGGAGGCAGG + Intronic
1102998145 12:117365161-117365183 CTGGGCAGGAGGAGGAAGGGAGG + Intronic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103401238 12:120644420-120644442 CTGGCCACAAAGAGGGAGTACGG - Intronic
1103597788 12:122034784-122034806 CCGGGAGAAAGGAGGGAGGATGG - Intronic
1103628997 12:122244064-122244086 ACGGGCAAGAGGAGGCAGGAAGG + Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1103917815 12:124385025-124385047 GAGGGAGAAAGGAGGGAGGAAGG + Intronic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104618202 12:130288529-130288551 CTGGACAGCAGGAGGGAGAATGG - Intergenic
1104737365 12:131144327-131144349 ATGGGGAAAAGGAGGTATGAGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105069895 12:133227919-133227941 CTGGGCAGAGGGAGGGGGGCGGG + Exonic
1105351930 13:19623692-19623714 GTGGGGAAAAGGAGGCAGGTGGG - Intergenic
1106121765 13:26865603-26865625 ATGGGCAAAAGAATGGAGGGTGG + Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107409283 13:40143556-40143578 GTGAGAAAAAGGAGGGAGAACGG + Intergenic
1108094377 13:46885291-46885313 CTGGGTAATACGAGGCAGGATGG + Intronic
1108807804 13:54181409-54181431 GTGGGCAGAGGGTGGGAGGAGGG - Intergenic
1109192582 13:59343250-59343272 CTGAGCAAAAGAAGGGGGGCGGG + Intergenic
1109204321 13:59465057-59465079 CTGAGCAACAGCAGGAAGGAGGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1111234836 13:85396496-85396518 GAGGGCAGAAGGTGGGAGGAGGG - Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1112503511 13:99959533-99959555 GTGGTCAAAAGGAGCGAGAAGGG + Intergenic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1113814054 13:113159418-113159440 CGAGAGAAAAGGAGGGAGGATGG + Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114522074 14:23346205-23346227 CAGGGCACAAGGAGGGAGAGGGG + Intergenic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114651949 14:24290893-24290915 TTGGGCACACGGAGGAAGGAGGG + Exonic
1114660022 14:24338132-24338154 GGGGGCACGAGGAGGGAGGAGGG + Intronic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1115730374 14:36262266-36262288 CAAGGCAACAGGAAGGAGGAGGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118758526 14:68863326-68863348 CTGGGAAGAAGCAGGGGGGAAGG + Intergenic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120330789 14:83090898-83090920 CACGGCAGAAGGAGTGAGGAGGG - Intergenic
1120509586 14:85397264-85397286 CTTGGCAATGTGAGGGAGGAGGG - Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120881623 14:89418342-89418364 CTAGCCAAAAGGAGGGACTAAGG + Intronic
1120887000 14:89459675-89459697 GTGGGCCAAGGGAGTGAGGAAGG - Intronic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121242574 14:92440905-92440927 CCAGGCAAAGGCAGGGAGGAGGG + Intronic
1121548090 14:94777441-94777463 TTGGGCAAAACAAAGGAGGAAGG - Intergenic
1121581783 14:95037311-95037333 CTGGGCAAAAGGAGGGCTATTGG + Intergenic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1121902447 14:97706332-97706354 CTGGGAAAAAGCAGGGAGGCTGG + Intergenic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122774926 14:104112917-104112939 CTGGGCAAAGGCAGGGTGGCAGG - Exonic
1123173635 14:106397959-106397981 GTGAGCGAAAAGAGGGAGGACGG - Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1124849700 15:33324321-33324343 CTGGGGAAATGGGGGAAGGAAGG + Intronic
1124865770 15:33489351-33489373 GAGGGCGAAAGGTGGGAGGAGGG - Intronic
1125724795 15:41862717-41862739 CTGGGCACAAGTGGGGAGGAGGG - Intronic
1125735675 15:41923858-41923880 ATGGGCAAAAGCAGGGAGCTTGG - Intronic
1125736303 15:41928869-41928891 CTGGGGAAAAGGGGGCAGGGAGG - Intronic
1125898711 15:43325696-43325718 GGGGGGAAAAGAAGGGAGGAGGG - Exonic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126353232 15:47767159-47767181 CTGCGCAAAAGGAGGGGAGAAGG - Intronic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1128484258 15:68069340-68069362 ACGGGCAAAAGGAAGGAGGAGGG - Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128739665 15:70074735-70074757 CAGGGCACAAGTAGGGGGGAGGG + Intronic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1128912662 15:71530369-71530391 CTGGGAGAAAGCGGGGAGGAAGG + Intronic
1129203980 15:74024412-74024434 CTGGGCAATAGCAGAGAGAAGGG + Intronic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129332131 15:74833148-74833170 AAGGGGAAAAGGAGGGAGGGAGG - Intergenic
1129669041 15:77596995-77597017 CAGGACAAAAGGAGGTGGGAGGG - Intergenic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1130541187 15:84821853-84821875 TTGAGCAGTAGGAGGGAGGAAGG + Intronic
1130560418 15:84953889-84953911 ATGGGCACCAGGAGGGATGAGGG + Intergenic
1131432769 15:92400100-92400122 CAGGGCAACAGCAGGAAGGATGG - Intronic
1131833393 15:96368367-96368389 CTGGGCAAAGGGGGTGGGGAAGG - Intergenic
1131900047 15:97077914-97077936 CTGGGCAGAAGGTGGGTGGAGGG - Intergenic
1132665918 16:1081270-1081292 CTGGGCAGACGGCGGGAGCACGG - Intergenic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1132934358 16:2473406-2473428 CTGGGTAGAAGGTGGGAGGCTGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133846067 16:9454907-9454929 CTGGACAAAGGGAGGAAGTAGGG - Intergenic
1133972494 16:10577983-10578005 CCCGGCAAAAGGAGGGAGGCTGG + Intronic
1134311172 16:13076471-13076493 GTGGGGGAAAGGAGGGAGCAGGG - Intronic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135591858 16:23710874-23710896 ATGGGCCCAAGGAGGGAGGAGGG + Intronic
1136056867 16:27696486-27696508 GAGGGCAGAAGGTGGGAGGAAGG - Intronic
1136173509 16:28502509-28502531 CTGGGCACATGGAGGAAGGATGG - Intronic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1138242221 16:55436276-55436298 ATGGGCCAGAGGAGAGAGGAGGG + Intronic
1138567875 16:57846597-57846619 GGGGGAGAAAGGAGGGAGGATGG - Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1138925476 16:61585143-61585165 CTTGGCAAGAGAGGGGAGGAGGG + Intergenic
1138988477 16:62361426-62361448 CTGGGCAGAAGAAAGAAGGATGG + Intergenic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1139933785 16:70552109-70552131 ATGGGGCAAAGAAGGGAGGAGGG - Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141087036 16:81103198-81103220 CTGGGTCTAAGGTGGGAGGATGG + Intergenic
1141225982 16:82115250-82115272 CAGGGGAAAAGGTGGGAGGGAGG - Intergenic
1141480716 16:84304863-84304885 CTGGGCCACAGGAGGGCAGAGGG + Intronic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1141920579 16:87132991-87133013 CTGGGACCAAGGAGGGAGAAGGG - Intronic
1141964427 16:87432414-87432436 CTGGGCAGCAGGAGGAAGAAAGG - Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142871698 17:2825312-2825334 TTGGGCAAGAGGAGGGAGAAGGG + Intronic
1142980302 17:3667767-3667789 CTAGGCAGAGGGAGGAAGGAAGG - Intronic
1142987525 17:3705413-3705435 CTGGGCAAAGGTAGGGAAGCTGG - Intergenic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143543132 17:7581310-7581332 TTGGGATAAAGGTGGGAGGAGGG - Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144363640 17:14520908-14520930 GAGGGCAGAAGGTGGGAGGAGGG - Intergenic
1145261256 17:21356031-21356053 CTGGGCAAAAGCCTGGAGGTGGG + Intergenic
1145984720 17:29037749-29037771 GGGGGCAAAGGGAGGGAGGATGG + Intronic
1146255236 17:31388494-31388516 CTAAGCAAAGGGAGGCAGGAGGG + Intergenic
1146299418 17:31676608-31676630 ATGGGAGGAAGGAGGGAGGAGGG + Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146790091 17:35746104-35746126 CTGGGCCAAAGGAACGAGGCAGG + Exonic
1146954736 17:36930953-36930975 GAGAGAAAAAGGAGGGAGGAAGG - Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147316456 17:39623188-39623210 ATGGGCAAAGGGATGGACGATGG + Intergenic
1147336155 17:39727900-39727922 CTGGGCTGAAGGCAGGAGGAGGG - Exonic
1147571266 17:41572448-41572470 GTGGGCACAAGGTGGGAGCAAGG - Intergenic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1148049186 17:44760767-44760789 CTGGGCAGAGGGAGGAAGGAGGG + Intronic
1148109567 17:45136953-45136975 CAGGGCAGGAGCAGGGAGGAAGG + Intronic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148324951 17:46777893-46777915 CTGGGCAACAGGAAGGAGACAGG - Intronic
1148450134 17:47772076-47772098 CTAGGCAGCAGGATGGAGGAAGG + Intergenic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149267308 17:54941013-54941035 CTAGGGAAAAGGAGAGAGGGAGG - Intronic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1149990500 17:61380643-61380665 CTGGGCACGAGGGGGTAGGAGGG - Intronic
1150268018 17:63843112-63843134 CTGGGCCAAAGGTGGGGGGGTGG - Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150810414 17:68352016-68352038 CTGGACATAAGGAGGGAGGGAGG + Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151877250 17:76873761-76873783 CTGGTCAAAAGGAGGGACATGGG + Intronic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152301010 17:79495397-79495419 AAGGGCACAAGGAGGTAGGAAGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152420208 17:80188696-80188718 CTGGGGAACAGCAGGAAGGAAGG - Intronic
1153162005 18:2216914-2216936 CAGGGCAGAAGGTGGGAGGAGGG + Intergenic
1153413377 18:4818741-4818763 CTCAGCAAAAGGAGGAAGGGAGG - Intergenic
1153851741 18:9101836-9101858 ATGGGCAAAAGGAAGGGGGTGGG + Intergenic
1154264218 18:12865664-12865686 CTGGGCAAAAAGAGTGAGCTGGG + Intronic
1155057092 18:22194442-22194464 CCTGCCGAAAGGAGGGAGGATGG + Intronic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1155988757 18:32257575-32257597 CTAGGCAGATGGAGGAAGGAAGG - Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1156918566 18:42490584-42490606 CAGGGCAACAGGAGGTAGAAAGG - Intergenic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158155726 18:54423378-54423400 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1158240042 18:55367342-55367364 GTTTGCAGAAGGAGGGAGGATGG - Intronic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158434853 18:57428421-57428443 GGGAGCAAAAGGAAGGAGGAGGG + Intergenic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159973026 18:74676951-74676973 GAGGGCAGAAGGAGGGAAGACGG - Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160391755 18:78539306-78539328 CTGGGCATCACGAGGGAGGGAGG - Intergenic
1160680719 19:410741-410763 CTGGGCCTGAGGCGGGAGGAGGG + Intergenic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1161374644 19:3933297-3933319 CTGGCCAGGAGGAGGGAAGAGGG + Intronic
1161426338 19:4205520-4205542 CTGGGCAAATGGCAGTAGGAGGG + Intronic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161676255 19:5651706-5651728 CTGGGAAACACCAGGGAGGAAGG - Intronic
1162062844 19:8107267-8107289 ATGGACAGAAGGAGGGGGGATGG + Intronic
1162095277 19:8306467-8306489 CTGGGCCAAGGGACAGAGGAAGG + Intronic
1162370988 19:10279194-10279216 CTGGGCAAAAGTTGGGAGCAGGG + Intronic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162979349 19:14228602-14228624 GTGGGCAGGAGGATGGAGGATGG + Intergenic
1163083799 19:14964223-14964245 AAGGGCAAGAGGCGGGAGGAAGG - Intronic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163582681 19:18147677-18147699 GTGGGCCCCAGGAGGGAGGAAGG + Intronic
1164731026 19:30504507-30504529 GGGGGCAGGAGGAGGGAGGAAGG - Intronic
1164794455 19:31014807-31014829 ATGGGAAAAGGGAGGGAGGGAGG + Intergenic
1165022597 19:32936404-32936426 CTGGGCAGCAGGAGGGAGACAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165489287 19:36114105-36114127 CTGGGCGAAGGGAGGAGGGAAGG - Intronic
1165501730 19:36194827-36194849 CTGGGTCAAAGGAGGGAGAGAGG - Intronic
1165792829 19:38502349-38502371 GTGGGCATAGGGTGGGAGGAGGG + Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1165937998 19:39401157-39401179 TTGGGCACAATGAGGGAGCAGGG + Intergenic
1165938603 19:39403840-39403862 CGGGGAAAAAGGGGGGAGGAGGG - Intergenic
1166709934 19:44930354-44930376 CTGGGCATACGCAGGGAGGCTGG + Intergenic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167254406 19:48418655-48418677 CGAGGGAGAAGGAGGGAGGAAGG + Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168052287 19:53838439-53838461 TTGGGGAAAAGGTGGGAGTAGGG + Intergenic
1168063286 19:53906149-53906171 ACAGGCAAATGGAGGGAGGAAGG - Intronic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168271381 19:55251635-55251657 CTGGGCAGAAGTGGGGAGGTGGG - Intronic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1168311492 19:55463239-55463261 CTAGGCAGAAGGAAGGGGGAAGG + Intergenic
1168358563 19:55718646-55718668 CTGGGCAACAGGTGGGGAGAGGG - Intronic
925836520 2:7951996-7952018 ATGGGCAACAGGAAGGAGGCTGG - Intergenic
926056338 2:9776220-9776242 CTGGCCTCCAGGAGGGAGGAGGG - Intergenic
926212384 2:10880462-10880484 CGGGGACACAGGAGGGAGGAGGG + Intergenic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
926459276 2:13108985-13109007 CAGGGGAAAAGGTGGGAGAAGGG + Intergenic
927185904 2:20482318-20482340 CTGGTCAAAAGAAGAGAAGAAGG - Intergenic
927365215 2:22287180-22287202 ATGGGAAAAAGAAGGGAGGGAGG + Intergenic
927421981 2:22943337-22943359 CTGGCAGAAAGGAGGAAGGAGGG - Intergenic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928361212 2:30663649-30663671 TTGGCCATAAGCAGGGAGGATGG + Intergenic
928572943 2:32627123-32627145 CTGGGCAATAGGAAAGAGGGAGG - Intergenic
928623971 2:33120322-33120344 GAGGGTAAAAGGAGGGAGAAGGG - Intronic
928961916 2:36935051-36935073 CTGGGCAACAGAGGGGAGGATGG + Intronic
929642532 2:43596046-43596068 CAGGGCAAAGGGAGGGAGAGAGG + Intronic
930654229 2:53992222-53992244 CTGGTGAAAAGAAGGAAGGAAGG - Intronic
931199266 2:60081271-60081293 TTGGGCAAAAGAAGGGCAGATGG - Intergenic
931692533 2:64847453-64847475 CCAGGCAGGAGGAGGGAGGAAGG + Intergenic
931748095 2:65308134-65308156 CAGGGCAGCAGCAGGGAGGAAGG + Intergenic
933775791 2:85770434-85770456 CTGGGGAAAAGGGGGGTGGGTGG + Intronic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934606599 2:95699830-95699852 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
935073024 2:99712483-99712505 TTGTGCCAAAGGAGTGAGGAAGG - Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935556376 2:104513748-104513770 GTGAGCAAGAGCAGGGAGGAGGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936524087 2:113231208-113231230 TTGTACAAAAGGATGGAGGAGGG + Intronic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
936540003 2:113341958-113341980 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
936928382 2:117761350-117761372 TTGGCCAAAAGGAAGGTGGAAGG - Intergenic
937859743 2:126698305-126698327 CTGGGCCCAATGAGGGAGAAAGG - Intergenic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
937984964 2:127634306-127634328 CTGGGCAGACGGTGGGCGGACGG + Intronic
938100180 2:128493124-128493146 CTGGGCAGGAGCAGGGTGGACGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938919825 2:135985331-135985353 CTGCGCCGAGGGAGGGAGGAGGG - Intronic
938964394 2:136375504-136375526 CAAGGAAAAAGGAGTGAGGAAGG + Intergenic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942266415 2:174230959-174230981 CTGGGCAAAAGAAGGATGCAAGG + Intronic
942398206 2:175574471-175574493 CTGGGCTAAAGGGGGCAGGTTGG - Intergenic
944399159 2:199305347-199305369 GGGGGTAAAAGGTGGGAGGAGGG + Intronic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
945045074 2:205774708-205774730 CTGGGGAATAGGTGGGAGGTGGG - Intronic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
946148694 2:217749604-217749626 GGGGGCAAAAGAAGGGAGGTAGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946355581 2:219182391-219182413 CTGGGGAACAGGTGGGAGAATGG - Exonic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947903771 2:233744292-233744314 CTCGGCCACAGGAGGGAAGAGGG + Intronic
947905160 2:233755643-233755665 CTCGGCCACAGGAGGGAAGAGGG + Intronic
948260923 2:236603960-236603982 CTTGGAGAAAGCAGGGAGGAAGG + Intergenic
948338254 2:237228336-237228358 CAGGAGAAAAGGAGGGAGTATGG + Intergenic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948612049 2:239176183-239176205 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612060 2:239176216-239176238 CTGGGCAGAGGGAGGGAGTGCGG - Intronic
948612078 2:239176267-239176289 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612086 2:239176286-239176308 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612097 2:239176319-239176341 CTGGGCAGAGGGAGGGAGTGCGG - Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948710358 2:239821451-239821473 CTGGGCCCAAGGAGGCAGCACGG + Intergenic
948786886 2:240357347-240357369 CTGTGCAAACGGAGGGCCGAGGG - Intergenic
948847003 2:240687955-240687977 CTGGGAAAAGGGTGGGAGAAGGG + Intergenic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
949047005 2:241876905-241876927 CTGGGCAGAAGGGGTGGGGAGGG - Intergenic
1168849722 20:968152-968174 CAGGGCAGAAGGAGGGGGAAAGG + Intronic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1169210612 20:3764435-3764457 CTGGGCAAAGGCAGGGCGGGGGG - Intronic
1169320749 20:4631491-4631513 GTGGCCAGAAGTAGGGAGGAGGG + Intergenic
1169357270 20:4917711-4917733 CTGGGCAACAGGAGGGTAGCAGG - Intronic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1171256635 20:23693566-23693588 CAGGGCCACAGGAGGGAGCAGGG - Intergenic
1171263987 20:23755497-23755519 CAGGGCCACAGGAGGGAGCAGGG - Intergenic
1171273179 20:23832341-23832363 CAGGGCGACAGGAGGGAGCAGGG - Intergenic
1171338278 20:24407743-24407765 GAGGGGAAAAGGAGGGAGCATGG + Intergenic
1172100257 20:32480983-32481005 CTGGGAAATATGAGGCAGGAAGG + Intronic
1172169008 20:32917591-32917613 CTGGGAAGCAGGAGGGATGATGG + Intronic
1172185699 20:33029800-33029822 CCAGGCAGAAAGAGGGAGGAAGG + Intergenic
1172187138 20:33038000-33038022 TTGGACAAAAGGAAGGTGGATGG - Intronic
1172230213 20:33331347-33331369 CTGCACAAAAGGAGGCAGCAGGG + Intergenic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172428071 20:34869539-34869561 CTGGGCAAGAGGGAGGAGGCAGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173183222 20:40820209-40820231 CTGGACGAAAGGAGGCAGGTAGG - Intergenic
1173502976 20:43566889-43566911 GTGGGTAGAAGGAGGGAGGGAGG + Intronic
1173741669 20:45406433-45406455 CTGGGCGGAGGGAGGAAGGATGG + Intronic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1173868251 20:46326562-46326584 CAGGGCAAAAGGAGACTGGAAGG + Intergenic
1173872951 20:46352972-46352994 CTGGGCTAAAGAAGGTAGGGCGG + Intronic
1174037450 20:47677023-47677045 CTGGGCAGAGGGAGGGAGGTGGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174079879 20:47963056-47963078 GTGGGGAAAAGAAGGGAGGGAGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174198500 20:48790428-48790450 CAAGGAAAAAGGAGGGTGGAGGG + Intronic
1174276796 20:49409857-49409879 CTGAGCAAAGGTAGGGAGGCAGG - Intronic
1174559416 20:51419421-51419443 ATGGGAAAAAAGAGGAAGGAGGG - Intronic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1174885099 20:54325144-54325166 GTGGGCAGAGGGAGGTAGGAAGG + Intergenic
1174890189 20:54383537-54383559 CTAGGCAAAAAGGGTGAGGAAGG - Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175733627 20:61370915-61370937 CGGGGGAAAGGGAGGGAGAAAGG - Intronic
1176045028 20:63088093-63088115 CTGCCCAACAGGAGGGAGCACGG + Intergenic
1176087381 20:63304248-63304270 CTGCGCACCTGGAGGGAGGAAGG - Intronic
1176087489 20:63304608-63304630 CTGCGCAGCTGGAGGGAGGAAGG - Intronic
1176545607 21:8196709-8196731 GGGGGCAAAAGGAGGAAAGAAGG - Intergenic
1176564558 21:8379754-8379776 GGGGGCAAAAGGAGGAAAGAAGG - Intergenic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1177381814 21:20354254-20354276 CAAGGCAAGATGAGGGAGGAAGG + Intergenic
1178396895 21:32250729-32250751 CTGGGAAATAGGTGAGAGGAGGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178480669 21:32977143-32977165 GAGGGAAAAAGAAGGGAGGAGGG - Intergenic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179096727 21:38322836-38322858 CTGCCCAAAAGGAGAGAAGAAGG + Intergenic
1179116703 21:38499832-38499854 ATGGGAGGAAGGAGGGAGGAAGG + Intronic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1179588449 21:42389046-42389068 CTGGGAAAAGGGAGGAAGGCAGG + Intronic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179888592 21:44324993-44325015 CTGGGCAGGAGAAGGCAGGAGGG + Intronic
1180170264 21:46054896-46054918 CGGGGCAGAGGGAGGGAGGGGGG - Intergenic
1180170276 21:46054924-46054946 CGGGGCAGAGGGAGGGAGGGGGG - Intergenic
1180170288 21:46054952-46054974 CGGGGCAGAGGGAGGGAGGGGGG - Intergenic
1180899758 22:19361689-19361711 GTGGGCTAAAGAAGGCAGGATGG + Intronic
1181328758 22:22072331-22072353 GTTGGCAAAAGCAGGGAAGAAGG - Intergenic
1181459512 22:23077958-23077980 CTGGGCAGGAGGAGGCATGAGGG - Intronic
1181573219 22:23779054-23779076 CTGGGCAAATGGAGAGGGAAAGG - Intronic
1181771233 22:25127288-25127310 TTGTGCAAAAGCTGGGAGGAAGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182038778 22:27219972-27219994 CTGGGCAAAAAGTGAGTGGAAGG + Intergenic
1182099215 22:27646058-27646080 CTGGGAGAAACTAGGGAGGATGG + Intergenic
1182126086 22:27816827-27816849 AGGGAAAAAAGGAGGGAGGAAGG - Intergenic
1182317745 22:29459148-29459170 CTGGGCAACAGGGTGGAGGTGGG + Intergenic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182455251 22:30446334-30446356 CTGAGCAAAGGCAGGGAGGCAGG - Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183036002 22:35141439-35141461 TTGGGCCAGAGGAGGGAGGCTGG - Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183272668 22:36871822-36871844 CTGGGCACCAGGAGGAAGGAAGG + Intronic
1183397476 22:37580250-37580272 CTGGGCTAAGTGAGGGAGGCTGG - Intronic
1183681242 22:39330731-39330753 TTGGGCAAGAGGTGGGGGGATGG + Intergenic
1183950091 22:41347932-41347954 CTGGGTCAGAGGAGTGAGGAAGG - Intronic
1184075214 22:42172697-42172719 GTGGGCTCAAGGAGGGAGGTAGG + Intronic
1184938372 22:47741426-47741448 CTGGGCAGAAGGAGGAAAGCAGG - Intergenic
1185002476 22:48254289-48254311 CTGGCCAGAAGGAGTGAGGGAGG + Intergenic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1203250478 22_KI270733v1_random:112946-112968 GGGGGCAAAAGGAGGAAAGAAGG - Intergenic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950001919 3:9663315-9663337 TTGGGAAAGAGGAGGAAGGAAGG + Intronic
950490575 3:13302236-13302258 CAAGGCCATAGGAGGGAGGATGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950799141 3:15535216-15535238 CTGGGGAAGAGAGGGGAGGAGGG + Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952817154 3:37455548-37455570 CTCGTCAAAATGAGTGAGGAAGG + Intronic
952948362 3:38496545-38496567 CTGGGCCAGCGAAGGGAGGACGG - Intronic
953135105 3:40175466-40175488 AAGGACAAAAGGAGGGAGGGAGG - Intronic
953374652 3:42418582-42418604 ATAAGAAAAAGGAGGGAGGAGGG + Intergenic
953430496 3:42835878-42835900 GTGGGCAGAAGGAGGAAGGAGGG - Intronic
953767748 3:45756948-45756970 CAGGGCAACAGGTGGGAAGAAGG + Exonic
953903678 3:46857625-46857647 AGGGAGAAAAGGAGGGAGGAAGG + Intergenic
953927408 3:46989439-46989461 CTGGGCCCAAGGAGGGGTGACGG + Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954292894 3:49659033-49659055 CTGGGCAGAATGTGGGAGGGTGG + Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954733848 3:52688396-52688418 TTGGTGAAAAGGTGGGAGGAGGG - Intronic
954882271 3:53844343-53844365 CTTGGCAAAAGGATAGGGGAGGG - Intronic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
955168546 3:56540125-56540147 CTGGTCTGAAGGAGGGAGGATGG - Intergenic
955596123 3:60592592-60592614 CTGGGCAGCAGGATGGAGGCAGG + Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956166003 3:66398704-66398726 CTGCGCAGCAGGAGGGGGGAGGG + Intronic
956955875 3:74339193-74339215 CTGGACAGCTGGAGGGAGGAGGG - Intronic
957503222 3:81084760-81084782 GTGTGCAAAAGAAGGGAGAAGGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
958833545 3:99117654-99117676 TTGGGCAATAGGAAGGAAGAAGG + Intergenic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961324711 3:126103334-126103356 CTGGGAAACAGGTGGGAAGACGG - Intergenic
961685836 3:128630120-128630142 CTGGGCAGCAGCAGGAAGGATGG + Exonic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962357646 3:134708715-134708737 GGGGGCAAAAGGGGGCAGGAAGG - Intronic
962832772 3:139158843-139158865 TTGGGCAGAGGCAGGGAGGAGGG + Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963038098 3:141049793-141049815 CTTGTCAATAGGAGGTAGGAAGG + Intergenic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963509655 3:146231010-146231032 GAGGGCAGAAGGTGGGAGGAGGG - Intronic
963774981 3:149429471-149429493 TTGACCAAAAGGAGGGTGGAGGG + Intergenic
963804716 3:149711611-149711633 CTGGGCAAAAGCAGGGACAGTGG - Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964524922 3:157607927-157607949 GTTGGCAGAAGGAGGGAGGGTGG - Intronic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
967077762 3:186019900-186019922 GTGTGCGAAAGGTGGGAGGAGGG + Intergenic
967183902 3:186929776-186929798 CTGCCCAACAGGAGGGCGGAAGG - Intergenic
967566399 3:190978749-190978771 CAGGGCAACAGGAGAGAGGTTGG - Intergenic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
968474845 4:799380-799402 CTGGGCACATGGAGGCTGGAAGG + Intronic
968477743 4:820392-820414 CTGGGCAAGAAGAGAGAGGCAGG + Intronic
969021476 4:4142817-4142839 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
969127792 4:4966504-4966526 CCAGACAATAGGAGGGAGGAAGG - Intergenic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969491088 4:7499654-7499676 TGGGGCAAAATGAGGGGGGATGG - Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
969732390 4:8964600-8964622 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
969791971 4:9498683-9498705 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
970047031 4:11866071-11866093 GAGGGCGAAGGGAGGGAGGAGGG + Intergenic
970554876 4:17220978-17221000 CAGGGCAAGTGGAGGGAGAAAGG - Intergenic
972161390 4:36232215-36232237 CATGGCAAAAGCAGTGAGGATGG - Intronic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972617529 4:40714532-40714554 GTGAGCATAAGGTGGGAGGAGGG + Intergenic
972659740 4:41104627-41104649 CAGGGCCAAGGGTGGGAGGAGGG - Intronic
974794414 4:66730168-66730190 TTGGGTAAAAGGAGGCAGGCTGG + Intergenic
975362102 4:73482759-73482781 ATGGGCAAAAGAAGGGTGGATGG - Intronic
975935362 4:79573105-79573127 CTGGGCCATAGAATGGAGGATGG - Intergenic
976006000 4:80431407-80431429 AGGGAAAAAAGGAGGGAGGAAGG - Intronic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
978856162 4:113397286-113397308 GTGAGCAAAACCAGGGAGGAGGG + Intergenic
978968108 4:114767819-114767841 CAGGGCAGAGGGTGGGAGGAGGG + Intergenic
980405858 4:132353528-132353550 CTGGGCAACAGTAGGCAGGGTGG + Intergenic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981550687 4:145938025-145938047 GGGGGCAAGAGAAGGGAGGAGGG - Intronic
981648446 4:147027231-147027253 CAGGGCAAAAGCAGAGAGCAGGG + Intergenic
982117230 4:152107746-152107768 CTGGACAAAAGGAAGGGGCAGGG + Intergenic
982235633 4:153249089-153249111 GTGGGGAAGAGGAGGGAGTAAGG - Intronic
983330715 4:166324379-166324401 CTAGCCAAAGGTAGGGAGGAGGG + Intergenic
984276173 4:177612628-177612650 CTGGGCAAAAGGAACTGGGAAGG + Intergenic
984502509 4:180574035-180574057 ATGGGCAAAAGGAAGAAGCAGGG + Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
984863112 4:184257299-184257321 TTGAGAAAAAGGAGGAAGGAAGG + Intergenic
985010165 4:185573913-185573935 CTGGGCCAGAGGCTGGAGGAAGG + Intergenic
985102340 4:186470865-186470887 AAGGGGAAAAGGAGGCAGGAGGG + Intronic
985483831 5:137781-137803 CTGGGCAATAGGATCGGGGACGG + Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
985955434 5:3262166-3262188 CAGGGCAACAGGAGGGAGAAGGG - Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988131514 5:27112720-27112742 CTAAGCAAAAGGAGGAAAGATGG + Intronic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988843092 5:35102359-35102381 ATGGGCAAAAGGATGGAGCGAGG - Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989102816 5:37837102-37837124 CGGGGGAAAAGGGGGGAGGTTGG + Intronic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
991095390 5:62734455-62734477 TTGGGCAAAAAGCGGGAGGAGGG - Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991245149 5:64502671-64502693 CTAGGCAGAAGAAGGGAGGTGGG + Intergenic
991649060 5:68833304-68833326 CTAGGAAAAAGGAGAGGGGAAGG + Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
991946172 5:71900405-71900427 CTGGGGAAAAGAAGGCAGGGTGG - Intergenic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993152153 5:84174559-84174581 CTAGGCAAATGGAGGATGGATGG + Intronic
993234686 5:85289304-85289326 GTGGGGAAGAGGAGGAAGGAAGG + Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994276885 5:97849446-97849468 CTGGGAAAAACAAGGCAGGAAGG - Intergenic
994513694 5:100742256-100742278 TGGGGGAAAAGGAGGGAGGGGGG + Intergenic
995114249 5:108461232-108461254 CTGGAGAAAAGCAGGTAGGAGGG - Intergenic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995337992 5:111024576-111024598 TGGGGAAAAAGGAGGTAGGAGGG - Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
996017468 5:118556662-118556684 GAGGGCAAAAGGAGGGCGGAAGG - Intergenic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
997647133 5:135489111-135489133 CTGGGCAAGGGAAGGGAGGGAGG + Intergenic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998228140 5:140342497-140342519 CTGGGCGGAAGTTGGGAGGAGGG - Intronic
998416505 5:141950105-141950127 TTGGCCTAAAGTAGGGAGGAAGG - Intronic
999523020 5:152372089-152372111 CTAGGCAATAGTGGGGAGGAAGG - Intergenic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1001191535 5:169637169-169637191 CTGCCCAACGGGAGGGAGGAGGG + Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1002001751 5:176199998-176200020 CATGGCCAAAGGTGGGAGGAGGG + Intergenic
1002252583 5:177938972-177938994 CATGGCCAAAGGTGGGAGGAGGG - Intergenic
1002880081 6:1243237-1243259 TTGGGCAGAAGGATGGGGGAGGG - Intergenic
1003162924 6:3651327-3651349 GGGGGAAAAGGGAGGGAGGAGGG + Intergenic
1004061710 6:12204381-12204403 CGGGGGAAAGGGAGGGAGAAAGG - Intergenic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006042182 6:31265702-31265724 CTGGCAAAAAGAAGGGAAGATGG + Intergenic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006939468 6:37742445-37742467 TTGGGCAAGAGGAGGCAGGAAGG - Intergenic
1007222043 6:40286459-40286481 CAGGGCAAGAGCTGGGAGGAGGG + Intergenic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007597501 6:43060398-43060420 GTGGGCAGAGGGAGGGAGGGAGG + Intronic
1007958023 6:45934628-45934650 CTGCGCAAAAGGAGGTTGGATGG + Intronic
1008333448 6:50270943-50270965 ACGGGCAAGAGGAGAGAGGAAGG + Intergenic
1008378997 6:50821802-50821824 GTAGGCAAGCGGAGGGAGGAAGG + Intronic
1008448460 6:51621230-51621252 CTGGGCATAATGAGGGAGCAAGG - Intronic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1009510939 6:64548885-64548907 ATGGGCAACAGTTGGGAGGAAGG - Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011412457 6:87080089-87080111 TTGGGAAAAAGGAGGGAAGGAGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1012004230 6:93692576-93692598 CTGGGCAAAAGGAGGCCTAAGGG - Intergenic
1012056296 6:94415356-94415378 CAAGGCAAAAGGAAGGAGTAAGG - Intergenic
1012437301 6:99227836-99227858 TTCAGCAAAAGGTGGGAGGAGGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014664276 6:124217068-124217090 CTGGGAAAATGGTGAGAGGATGG + Intronic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015414264 6:132930885-132930907 CTGAGCAGCAGGAGGGAGGGTGG + Intergenic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015562596 6:134532809-134532831 GTGGGAGAAAGGAGGGTGGAAGG + Intergenic
1016634795 6:146275558-146275580 ATAGGAAAAAGGAGAGAGGAAGG - Intronic
1016833411 6:148454521-148454543 TTAGGCAAAAGCAGAGAGGAAGG + Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018472785 6:164111465-164111487 CTGCTAAAAAGGAGGGAGGGAGG + Intergenic
1018659407 6:166072216-166072238 CTAAGCCAAAGGAGGGAGGTAGG - Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018807752 6:167274372-167274394 TTAGGCAGGAGGAGGGAGGACGG - Intronic
1018824609 6:167399594-167399616 CTGGGATAAAGGAGGGCGGGCGG + Intergenic
1018872683 6:167795595-167795617 TTGGTCCAAAGGAGGGAGGCTGG - Intronic
1018969271 6:168514860-168514882 CTTAGACAAAGGAGGGAGGATGG + Intronic
1018987726 6:168650219-168650241 CAGAGCAAAAGGAGGCAGTAGGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020308898 7:6854846-6854868 CGGGGCCTCAGGAGGGAGGAGGG + Intergenic
1020688906 7:11330253-11330275 CTGGGGCAAATGAGAGAGGAGGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021547987 7:21837565-21837587 GGAGGTAAAAGGAGGGAGGATGG + Intronic
1021851665 7:24814642-24814664 CGGGGCTGCAGGAGGGAGGAAGG - Intronic
1022174537 7:27860867-27860889 TTAGGAAAAAGGAGGGACGAGGG - Intronic
1022454632 7:30547540-30547562 CGGGTCCAAAGGAGGAAGGATGG + Intronic
1022474684 7:30702089-30702111 CTGAGCAGAAGCAGGGAGCAAGG + Intronic
1023805848 7:43872443-43872465 AAGGGCAGAAGAAGGGAGGAGGG + Intronic
1023845167 7:44116352-44116374 CTGGGCAACAGAAGGCAGGCAGG - Intronic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1023860892 7:44217252-44217274 CTCAGCAAAAAGAGAGAGGAGGG + Exonic
1024054336 7:45649991-45650013 CTGGGCAGAAGCAGGAAGGAAGG + Intronic
1024642840 7:51344943-51344965 CTGGGCTAATGGAGGGGGGTGGG + Intergenic
1024851981 7:53729568-53729590 CAGGGCAAATGGTGGGAGGAGGG - Intergenic
1026268524 7:68816452-68816474 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1027218362 7:76198557-76198579 CTGGGCAAAGGAAGAGGGGAGGG + Intergenic
1028136432 7:87227754-87227776 CTTGTCAAAAGAAGGAAGGAAGG + Intergenic
1028947645 7:96599043-96599065 AGGGGCAGAGGGAGGGAGGAAGG + Intronic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1031974296 7:128084225-128084247 GGGGGCAAAAGTAGGGATGAAGG - Intronic
1031982255 7:128135675-128135697 CGGGCCAAAAGGAGGATGGAGGG + Intergenic
1032410409 7:131690124-131690146 CTTGGCACATGGAGGGAGGGTGG + Intergenic
1032515195 7:132501655-132501677 CTGGCCAAAAAGAGGGAGGTGGG + Intronic
1032529279 7:132606757-132606779 CTGAGAAAAATTAGGGAGGAGGG + Intronic
1032825202 7:135561940-135561962 CTGGGCAGAGTGAGGGAGGGAGG - Intronic
1033090692 7:138383065-138383087 TTTGGCAAAAGGAAGGAGGAAGG - Intergenic
1033432786 7:141304423-141304445 CTGGGCAGAAGGTGGGAAGAGGG - Intronic
1034433797 7:151053603-151053625 CTGGGCAGAGGAAGGGAGGGTGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035058507 7:156052239-156052261 ATGGGCAAATGGAGGGATGGAGG - Intergenic
1035283013 7:157788982-157789004 CTTGGGAAATGGAGGCAGGAAGG - Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035545372 8:478187-478209 CTGGGCAGGAGGGGAGAGGAGGG - Intergenic
1035720500 8:1787905-1787927 CAAGGAAAAAGGAGGCAGGAAGG - Intergenic
1035774540 8:2177998-2178020 GTGGGCGGGAGGAGGGAGGAGGG + Intergenic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036533473 8:9620338-9620360 CAGGGCTAAAGCAGTGAGGATGG - Intronic
1036675954 8:10833445-10833467 AGGAGAAAAAGGAGGGAGGAAGG + Intronic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1038098020 8:24337417-24337439 GTCGGACAAAGGAGGGAGGAGGG - Intronic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038949779 8:32401733-32401755 GAGGGCAGAAGGTGGGAGGAGGG + Intronic
1039261857 8:35780455-35780477 CCGAGGAAAAGGATGGAGGAAGG + Intronic
1039367539 8:36946364-36946386 CTGAGCAAAAGGAGCGAAGCTGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039910941 8:41826390-41826412 CTGGGCAGCAGGAGTGAGCATGG - Intronic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1040386723 8:46919166-46919188 TTGGACACAAGGAGGGAGGGGGG + Intergenic
1040652704 8:49466563-49466585 CAGGACAAAATGAGGGAAGAGGG + Intergenic
1041040440 8:53841274-53841296 TTGGGCTAACGGAGGGAGGAAGG - Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041280083 8:56199890-56199912 ATGAGCAAAAGGAGAGAGAATGG + Intronic
1041338641 8:56817092-56817114 TTAGGCAAAAGGAGAAAGGAAGG + Intergenic
1041354999 8:56991055-56991077 CTGGGCATTAGGAGAGGGGAAGG + Intronic
1041800475 8:61792471-61792493 CAGGGAAAAAGGAGGGAGAGTGG + Intergenic
1043719441 8:83528542-83528564 AGGGGCAAAGGGAGGGAGAAGGG + Intergenic
1043766856 8:84146368-84146390 CTGGACAGAGGGAGGGGGGAAGG + Intergenic
1043772494 8:84223059-84223081 CAGGGCAAAGGGAGAGAGAAAGG - Intronic
1044289101 8:90446905-90446927 GAGGGCAATAGTAGGGAGGAAGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1045426786 8:102075008-102075030 CCAGGCAAAAGGAAGGAGGAAGG + Intronic
1045789474 8:105965434-105965456 CTGAGCAAAGGGAGAGATGAAGG - Intergenic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1046643265 8:116755923-116755945 CTGGAAAACAGGAGGGAGGCGGG - Intronic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047009363 8:120654288-120654310 CTAGGAAAAAAGAGGGAGGGAGG + Intronic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047928615 8:129704461-129704483 CAGGAAAAAAGGAGGGAAGAAGG - Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048152501 8:131907842-131907864 GTGGGTAGAAGAAGGGAGGAAGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049592181 8:143467767-143467789 CTGGGCAGAGGGCGGGAGGGAGG - Intronic
1051138517 9:13951536-13951558 CCGGGCAGAAGAATGGAGGAAGG + Intergenic
1051457291 9:17272886-17272908 AAGGGCAGAAGGAGGGAGGGAGG - Intronic
1051475744 9:17507130-17507152 GTGGGGAAAAGGAGGGAGAGAGG - Intergenic
1051698066 9:19789725-19789747 CTGGGCCAAAGAATGGAAGACGG + Intergenic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1052398963 9:27976658-27976680 GTGGGCAAAAGTAGAGATGATGG - Intronic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1052744191 9:32423749-32423771 CAGGGCAAAGGGTGGGAGGGAGG + Intronic
1053286330 9:36851721-36851743 ATGAGCAAAGGCAGGGAGGAGGG + Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056178927 9:84062663-84062685 CTGGGAAAAAGGAGGCAGGCAGG + Intergenic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1057527099 9:95812508-95812530 CTGGGAAAAAGAAAAGAGGATGG - Intergenic
1057825911 9:98371931-98371953 CTGGGCAGCAGGAAGAAGGAAGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058498538 9:105587293-105587315 TTGGTTAGAAGGAGGGAGGAGGG + Intronic
1058945546 9:109852257-109852279 CATTCCAAAAGGAGGGAGGAAGG - Intronic
1059328095 9:113516983-113517005 CTGGGCAAGGTGAGGGAGTAGGG + Intronic
1059341919 9:113602158-113602180 CGGGGCAGAGGGAGGGAGGCTGG + Intergenic
1059454367 9:114390232-114390254 ATGAGCAAAGGCAGGGAGGAGGG - Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1059870091 9:118563290-118563312 GGGGGCAATAGGAGAGAGGATGG - Intergenic
1060423599 9:123486785-123486807 GTGGTCAATAGGAGGGTGGAGGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061383953 9:130277156-130277178 CTGGGCAAGAGGAGGGTGTGGGG - Intergenic
1061612804 9:131759546-131759568 CAAGGAAAAAGAAGGGAGGAAGG + Intergenic
1061679573 9:132236281-132236303 GTGGGTTAAAGGAGGGAGGGCGG + Intronic
1061789004 9:133048780-133048802 TGGGGTAAAATGAGGGAGGAGGG + Intronic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062538219 9:137030198-137030220 CTGGGCTCAGGGAGGGAGGGCGG - Exonic
1203466879 Un_GL000220v1:96218-96240 GGGGGCAAAAGGAGGGAAGAAGG - Intergenic
1185610929 X:1393106-1393128 CGGAGAAAAAGGAGGGAGGCGGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1187724929 X:22192548-22192570 CGGAACAGAAGGAGGGAGGAAGG - Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1189740380 X:44111622-44111644 ATGGGCAAAAGCAGGGAAGAGGG - Intergenic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190534175 X:51409101-51409123 CTGGAGAAAAGGAGGGGTGATGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1190957419 X:55209068-55209090 GTGGGCAGATGGTGGGAGGAAGG + Intronic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1193231074 X:79047298-79047320 TTGGGAAAAAGGTGGGAGTACGG + Intergenic
1193956709 X:87872732-87872754 CAGGGCAAAAGAAAGGAGAAAGG - Intergenic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196196217 X:112840812-112840834 CTGGGCAAAGGATGGGAGGTAGG + Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1198018807 X:132638185-132638207 CTGGGTCAAAGCAAGGAGGAAGG + Intronic
1198112062 X:133510366-133510388 AGGGAGAAAAGGAGGGAGGAAGG - Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1198321584 X:135522370-135522392 CAGGAGAAAAGTAGGGAGGACGG + Intronic
1199040622 X:143111360-143111382 CTGGGCAAGAGAAGGCAGGGTGG - Intergenic
1199051391 X:143240540-143240562 ATTGGAAAAAGGAGGCAGGATGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200222912 X:154400645-154400667 CTGGGGCAAAGGTGGGAGAAGGG - Intronic
1200837578 Y:7748288-7748310 CTGGGCAACAGCAGGGAGTGTGG - Intergenic
1202587187 Y:26443860-26443882 CTGGGCAACAGAGGGGAGGAGGG - Intergenic