ID: 1140110341

View in Genome Browser
Species Human (GRCh38)
Location 16:71998692-71998714
Sequence CTTTGGAAGGTGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81859
Summary {0: 3, 1: 47, 2: 683, 3: 8302, 4: 72824}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140110341_1140110349 20 Left 1140110341 16:71998692-71998714 CCATCCACCTCCACCTTCCAAAG 0: 3
1: 47
2: 683
3: 8302
4: 72824
Right 1140110349 16:71998735-71998757 GCCACCACACCCACCCTGCCAGG 0: 1
1: 0
2: 20
3: 177
4: 959
1140110341_1140110347 -8 Left 1140110341 16:71998692-71998714 CCATCCACCTCCACCTTCCAAAG 0: 3
1: 47
2: 683
3: 8302
4: 72824
Right 1140110347 16:71998707-71998729 TTCCAAAGTGCTAGGATTACAGG 0: 949
1: 32879
2: 322946
3: 253370
4: 135507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140110341 Original CRISPR CTTTGGAAGGTGGAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr