ID: 1140112423

View in Genome Browser
Species Human (GRCh38)
Location 16:72015408-72015430
Sequence AGGGCTTTATACAGTCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140112423_1140112424 -5 Left 1140112423 16:72015408-72015430 CCTTCTAGACTGTATAAAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1140112424 16:72015426-72015448 GCCCTTCCCTTTGTCATCCCTGG 0: 1
1: 0
2: 5
3: 31
4: 219
1140112423_1140112432 24 Left 1140112423 16:72015408-72015430 CCTTCTAGACTGTATAAAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1140112432 16:72015455-72015477 TTTACTACAGCAAACCCAAAAGG 0: 1
1: 0
2: 0
3: 26
4: 200
1140112423_1140112426 -4 Left 1140112423 16:72015408-72015430 CCTTCTAGACTGTATAAAGCCCT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1140112426 16:72015427-72015449 CCCTTCCCTTTGTCATCCCTGGG 0: 1
1: 0
2: 2
3: 31
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140112423 Original CRISPR AGGGCTTTATACAGTCTAGA AGG (reversed) Intronic