ID: 1140113926

View in Genome Browser
Species Human (GRCh38)
Location 16:72025696-72025718
Sequence CTGTCTCCACGGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140113926_1140113934 7 Left 1140113926 16:72025696-72025718 CCCATTTCCCACCGTGGAGACAG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1140113934 16:72025726-72025748 GGGGACATCCCCAGCTCCTCTGG 0: 1
1: 0
2: 2
3: 22
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140113926 Original CRISPR CTGTCTCCACGGTGGGAAAT GGG (reversed) Intronic
900707639 1:4090420-4090442 ATGCCTCCACAGGGGGAAATCGG + Intergenic
901943034 1:12678440-12678462 CTGTCTCCATGGGAGGGAATGGG - Intergenic
902513691 1:16979200-16979222 CTGGCTACACGGTGGGACTTGGG + Intronic
903302355 1:22388556-22388578 CAGTCTCCACGCTGGTAAAATGG - Intergenic
904802406 1:33103139-33103161 CTGTCTGCAGCGTGGAAAATGGG - Intronic
910887311 1:91978628-91978650 CTGTCCCCTCAGTGGGACATGGG - Intronic
912975986 1:114330740-114330762 CTGCTTCCAAGGTGGGATATTGG + Intergenic
917599539 1:176560468-176560490 CTGTCTCCGCTATGGGAAATAGG - Intronic
920284191 1:204868081-204868103 CACTTTCCACGCTGGGAAATGGG + Intronic
922660096 1:227422375-227422397 CTGCCTCTACGGTGGTAGATTGG - Intergenic
922786028 1:228282714-228282736 CTGTCACCACGGTGGGACTTGGG - Intronic
1063356478 10:5403975-5403997 ATGTTTCCACTGCGGGAAATGGG - Intronic
1063982384 10:11464565-11464587 CTGCCTCCACGGTGGTATAGTGG - Intronic
1069838135 10:71322149-71322171 CTGTCTCTAAGGAGGGAAACTGG - Intronic
1070372306 10:75793954-75793976 CTGTCCCCATAGTGGGAAAACGG + Intronic
1072210667 10:93243949-93243971 CTGTCTTCAAGGTGGGAAACTGG - Intergenic
1072541339 10:96400474-96400496 CTGTTTCCAAACTGGGAAATGGG - Intronic
1072801996 10:98398629-98398651 CACTTTCCACGATGGGAAATGGG + Intronic
1074235354 10:111579416-111579438 CTGTCTTCAAGCTGGGATATTGG - Intergenic
1074670232 10:115781857-115781879 CTTTCTCCACGGGCTGAAATCGG + Intronic
1075659931 10:124186369-124186391 CTGTCTCCATTGTGGTAAGTTGG + Intergenic
1077590730 11:3489042-3489064 GTGACTCCTCGGTGGAAAATCGG - Intergenic
1080456408 11:32423507-32423529 CTTTCACAACTGTGGGAAATAGG + Intronic
1084246451 11:67860827-67860849 GTGACTCCTCGGTGGAAAATCGG - Intergenic
1084733885 11:71092070-71092092 CTGTCAGGACGGTGGGAACTTGG + Intronic
1084826230 11:71733674-71733696 GTGACTCCTCGGTGGAAAATCGG + Intergenic
1089096418 11:115923472-115923494 CTGCCTGCACGGTGGGGATTGGG + Intergenic
1089676232 11:120091799-120091821 CTGTCTTCAAGCTGGGACATTGG + Intergenic
1094027719 12:25976273-25976295 CTGTCTGGAGGATGGGAAATTGG + Intronic
1100615736 12:96230572-96230594 CTGTCTCCACCCTGGGGACTTGG - Intronic
1101151053 12:101882755-101882777 CAGTCTCCATGGTGGGACTTGGG + Intronic
1103257454 12:119554294-119554316 CTGTCTGCAGGGTGGAGAATGGG + Intergenic
1104941647 12:132398079-132398101 TTGTCTACACGGTGGGCAAGAGG + Intergenic
1105831686 13:24167919-24167941 ATGTCTCCACAGTAGGAAAAGGG - Intronic
1109183668 13:59244956-59244978 CTATCTGCACGGTTGAAAATAGG + Intergenic
1116974151 14:51096476-51096498 CTGTCTGGAAGGTGGAAAATTGG - Intergenic
1117610034 14:57473686-57473708 CTGTCTACACTGTGGAGAATGGG - Intronic
1117814467 14:59582865-59582887 CTGTCACAGAGGTGGGAAATTGG + Intergenic
1118769995 14:68936398-68936420 CTGCCTCCAGGGAGAGAAATGGG + Intronic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1122384532 14:101334883-101334905 CTGTCTCCACTCTGGGGAGTTGG - Intergenic
1126064359 15:44814536-44814558 CTGTCTTCAAGCTGGGACATTGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1131694802 15:94864852-94864874 CTGTCTCCACCGTGAAAATTTGG + Intergenic
1133305214 16:4804179-4804201 CTGTCTCCACGGGAGGAAGAGGG + Exonic
1133356101 16:5138140-5138162 GTGACTCCTCGGTGGAAAATTGG - Intergenic
1134504348 16:14792880-14792902 CTGTCTCCACGTGGGAACATGGG - Intronic
1134576225 16:15336029-15336051 CTGTCTCCACGTGGGAACATGGG + Intergenic
1134726218 16:16420473-16420495 CTGTCTCCACGTGGGAACATGGG - Intergenic
1134941216 16:18291387-18291409 CTGTCTCCACGTGGGAACATGGG + Intergenic
1135630948 16:24035308-24035330 CTGTCTCAAAGGAGGGAAACAGG + Intronic
1136140313 16:28284072-28284094 CAGTCACCACCGTGGGCAATGGG - Intergenic
1137314178 16:47299414-47299436 TTGCTTCCAAGGTGGGAAATAGG + Intronic
1137338541 16:47574334-47574356 ATGTCTCCAGGGTGTGAAAGCGG - Intronic
1139545531 16:67647967-67647989 CTGTCTTCAGGGTGGGAGCTTGG + Intronic
1139589352 16:67924847-67924869 CTGTCTCTCCGGTGGGTGATGGG + Intronic
1140113926 16:72025696-72025718 CTGTCTCCACGGTGGGAAATGGG - Intronic
1141668787 16:85480622-85480644 CTGTCTCCCAGGAGGGCAATCGG - Intergenic
1142977800 17:3656030-3656052 CTGGCACCACTGTGGGGAATGGG - Intronic
1147594085 17:41705585-41705607 CTGTGTTCACGGTGGGGAAAAGG + Intergenic
1148379165 17:47180359-47180381 CTGTCTCCTCGGTGGAGAATGGG - Intronic
1150216909 17:63476384-63476406 CTGTGTCCTCGGGGGGAAAGAGG + Intergenic
1151698310 17:75729426-75729448 CTGTGTGCACGGTGGGCACTGGG + Exonic
1153880170 18:9415591-9415613 CTGCCTCCAGGGAGGGAAAACGG + Intergenic
1155073432 18:22335879-22335901 CTGTCTGCTCGGTGGGAGAGTGG + Intergenic
1158702270 18:59759046-59759068 ATGTGACCACGGTGGGAAACTGG + Intergenic
1159506939 18:69350835-69350857 TTGTCTCCAGGGTGGGATTTAGG - Intergenic
1161914425 19:7218012-7218034 CTGTCTCCACTGTGGGAGGATGG + Intronic
1162573972 19:11487893-11487915 CTGTCCCCACAGTGGGCAATGGG - Exonic
1164558613 19:29272649-29272671 CTGTCTGCAAGCTGGGACATCGG - Intergenic
1168153483 19:54461066-54461088 CAGACTCCCCGGTGGGAAAACGG - Exonic
926780286 2:16464706-16464728 CTGTCTCTAAAGTGAGAAATGGG - Intergenic
930603282 2:53466594-53466616 CTGTCTTCAAGCTGGGACATTGG + Intergenic
931139019 2:59436628-59436650 GTCTCTCCAGGGTGGGAAATGGG - Intergenic
931678672 2:64724113-64724135 CCATCTCCACCGTGGGAACTGGG + Intronic
932958421 2:76383446-76383468 GTGTGTCCTTGGTGGGAAATGGG + Intergenic
937631769 2:124109602-124109624 CTGTCCCCAGGCAGGGAAATCGG - Intronic
940497930 2:154457546-154457568 CTGCTTCCACTGTGGGAAAGAGG + Intergenic
943586231 2:189743873-189743895 CTGTTTCCACCCTGGGAATTTGG - Intronic
947538896 2:230960945-230960967 CTGTCTTCACAGTGAGAAACTGG - Intronic
948894011 2:240919896-240919918 CTGTCTCCACGGTGGGACCCTGG - Intronic
1168954072 20:1821992-1822014 CTGGCTCAAGGGAGGGAAATGGG - Intergenic
1170273792 20:14559894-14559916 CTGTCTCTCCGGTGTGAAACAGG + Intronic
1170697879 20:18676286-18676308 CTGACTCCAAGGTGGGGAAGGGG - Intronic
1173351647 20:42251034-42251056 ATGTCTCCAGCCTGGGAAATGGG - Intronic
1175108124 20:56628761-56628783 CTGTGCCCACGGAGGGAACTGGG + Intergenic
1178499019 21:33110508-33110530 CTCACTCCGCGGCGGGAAATGGG - Intergenic
1182547229 22:31083319-31083341 CTGTCCCCACAGTGGGTGATGGG - Intronic
1184371265 22:44083559-44083581 CTTTCCAGACGGTGGGAAATGGG + Intronic
1184430312 22:44438472-44438494 CTGTCTCCACCTGGAGAAATGGG - Intergenic
1184783864 22:46662438-46662460 CAGCCTCCACGGCGGGAAACCGG - Intronic
951913258 3:27773377-27773399 CAGTGTCCACTGTGGGAAACTGG - Intergenic
952523064 3:34181697-34181719 CTGTCTTCAAGCTGGGACATCGG - Intergenic
954637268 3:52077827-52077849 CTATCTCCACGTTTGCAAATTGG - Intronic
960248236 3:115423306-115423328 CTCTCACCACAGTGTGAAATAGG + Intergenic
961292622 3:125859822-125859844 GTGACTCCTCGGTGGAAAATCGG + Intergenic
961894563 3:130156551-130156573 GTGACTCCTCGGTGGAAAATCGG - Intergenic
964138716 3:153373230-153373252 CTGACTCCTCAGTGGAAAATAGG - Intergenic
967515170 3:190360228-190360250 CTGTTTCCAGGGAGGAAAATAGG + Intronic
968622905 4:1611691-1611713 CTGTCCACACGGTGGGCAAGGGG + Intergenic
968737186 4:2303620-2303642 CTGTCTCCAGAGTGGGGGATGGG + Intronic
969809238 4:9635064-9635086 GTGACTCCTCGGTGGAAAATCGG + Intergenic
971723795 4:30282176-30282198 CTGTCAACAAGCTGGGAAATGGG + Intergenic
979360928 4:119764158-119764180 CTGTCTTCAAGCTGGGACATTGG + Intergenic
980098602 4:128519016-128519038 CTGTGCCCACGGTGGGAAGGAGG + Intergenic
983265269 4:165501445-165501467 CTGTCTCTAGGGAGGAAAATGGG - Intergenic
985913301 5:2899193-2899215 CTGGGTCCACGGTGGGAAAATGG - Intergenic
990169995 5:53037442-53037464 CTGTTACCAAGGTGGGAAATTGG - Intronic
992310602 5:75495012-75495034 ATGTCTCAAGGGTGGGAGATAGG - Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
1004314002 6:14570581-14570603 CTGGCTCCATGGTGGGAAGAGGG + Intergenic
1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG + Intergenic
1013447472 6:110245259-110245281 CTGTCTTCAAGCTGGGACATGGG + Intronic
1014923672 6:127244252-127244274 CTCTCTCTAGGGTGGGGAATAGG + Intergenic
1024307370 7:47939864-47939886 CTGCCTCCCAGGTGGGAAGTAGG - Intronic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1028647959 7:93119579-93119601 CTGTCTCCACTGAGTGACATAGG - Intergenic
1028723222 7:94057978-94058000 CTGTCTTCAAGCTGGGACATTGG - Intergenic
1034992355 7:155555862-155555884 CTGTTTCCTCTGGGGGAAATGGG + Intergenic
1035475537 7:159141444-159141466 CGGTCTCCACGCTGGACAATGGG - Intronic
1037678619 8:21074123-21074145 CTCTCCCCTGGGTGGGAAATCGG + Intergenic
1039280723 8:35981036-35981058 CTGTCTCCAAGCTGGCAAAAAGG - Intergenic
1040450348 8:47539856-47539878 CTCTCTCCATGGTGGGAAGCTGG + Intronic
1041160826 8:55042101-55042123 CTGTCTTCAGGCTGGGATATTGG - Intergenic
1041508239 8:58625173-58625195 CTGTCTTCAAGCTGGGATATTGG + Intronic
1045524623 8:102930993-102931015 CTGTCTTCAAGCTGGGACATTGG + Intronic
1047814168 8:128444695-128444717 TTGTGACCAAGGTGGGAAATTGG + Intergenic
1052826608 9:33180773-33180795 CTGCCTCCATGGTGGGAGCTAGG + Intergenic
1055352590 9:75404552-75404574 ATTTCTCCATGATGGGAAATAGG - Intergenic
1056941573 9:90960842-90960864 CTGTGACCACGGTGGGCAACAGG + Intergenic
1059853716 9:118371922-118371944 CTGTCCCCTTGGTGGGGAATGGG - Intergenic
1060912391 9:127361511-127361533 CTGTCTCCACCTTGGGACAGGGG - Intronic
1061400218 9:130364499-130364521 ATGTTTCCACCGAGGGAAATTGG - Intronic
1186983635 X:14986121-14986143 CTTTCTCCATGGTGGCAAAATGG + Intergenic
1189005921 X:36994930-36994952 CTGTCTCCATGGCGGGAAGGAGG - Intergenic
1189162119 X:38820103-38820125 CCATCTTCACTGTGGGAAATGGG + Intergenic
1190751513 X:53366067-53366089 CAGTTTCCATAGTGGGAAATAGG + Intergenic
1194398931 X:93419614-93419636 CTCTCTTCACAGTGGGAGATGGG - Intergenic
1198271424 X:135059683-135059705 CAGTCTCCAATGTGGGACATGGG - Intergenic
1198832464 X:140764921-140764943 CAATCACCACGGTGGTAAATAGG + Intergenic
1200887445 Y:8282825-8282847 GTGTGTCCACGGTGGGAAACTGG + Intergenic