ID: 1140116378

View in Genome Browser
Species Human (GRCh38)
Location 16:72045006-72045028
Sequence CCGTGGGACCCTGTAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140116375_1140116378 -8 Left 1140116375 16:72044991-72045013 CCTATGTTCCAGGCACCGTGGGA 0: 1
1: 0
2: 2
3: 32
4: 336
Right 1140116378 16:72045006-72045028 CCGTGGGACCCTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 149
1140116371_1140116378 21 Left 1140116371 16:72044962-72044984 CCGTAAGGCAGTGCAACTGGGAA 0: 1
1: 0
2: 0
3: 20
4: 136
Right 1140116378 16:72045006-72045028 CCGTGGGACCCTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140116378 Original CRISPR CCGTGGGACCCTGTAGCCCC TGG Intronic
900124363 1:1062924-1062946 CCCTGGGACCCCACAGCCCCTGG + Intergenic
900130379 1:1084829-1084851 CCCTGGGACCCTGGAGCCTGGGG - Intronic
900410619 1:2510939-2510961 CTCTGGGGCCCTGAAGCCCCTGG - Intronic
900579888 1:3403654-3403676 CCTTGGGGACCTGTGGCCCCCGG + Intronic
900680920 1:3915749-3915771 ACCTGGGACACTGTGGCCCCTGG + Intergenic
902302252 1:15510594-15510616 CCATGGGCACCTGTAGCCCTTGG - Intronic
902433887 1:16384595-16384617 CCAGGAGACCCTGTAGCCCAGGG + Intronic
902636010 1:17735578-17735600 CCCTGGGTTCCTGCAGCCCCTGG + Intergenic
902888845 1:19426672-19426694 CAGTGGGAGCCTGGAGCACCTGG - Intronic
903342092 1:22660925-22660947 CCAGGGGCCCCTGGAGCCCCAGG + Exonic
904602845 1:31683350-31683372 CAGGGGGAGCCTGGAGCCCCGGG - Exonic
905564296 1:38951425-38951447 CGGTGGGAGCCTGTAATCCCAGG - Intergenic
912147951 1:106817531-106817553 CCGGGGGGCCTTGTAACCCCAGG + Intergenic
916221179 1:162446426-162446448 ACGTGGGACACAGCAGCCCCTGG - Intergenic
918044709 1:180935013-180935035 CGGTGGGAGACTGTAGCCCAGGG + Intronic
1064081047 10:12308275-12308297 CCGTGGGAGGCTGCTGCCCCAGG + Intergenic
1064250355 10:13701896-13701918 CCCTGGGACGCTGTAGCCTGTGG - Intronic
1065019797 10:21494854-21494876 CCGTGGGAACCTCCAACCCCGGG - Exonic
1067774657 10:49154261-49154283 CCATTGGACCCTGCATCCCCAGG + Intergenic
1069962720 10:72087922-72087944 CCCTGGGACCCCCCAGCCCCGGG - Intronic
1073147676 10:101291562-101291584 CCCTGGGACCCTAGAGCCCCGGG - Intergenic
1073499364 10:103921992-103922014 CCGAGGGACCTTGTAGGCCATGG + Intergenic
1074499804 10:114012962-114012984 CTGGGGGACCCTGGAGCCCTGGG - Intergenic
1076477232 10:130761344-130761366 CTGTGGGAGCCTGAGGCCCCCGG + Intergenic
1077144888 11:1040394-1040416 CGGTGGGAACCTGGAGACCCTGG + Intergenic
1077246604 11:1542298-1542320 CCGTGGGGGCCTGGTGCCCCTGG + Intergenic
1083300086 11:61735623-61735645 CCGGGGGACCCTGTCCCCCAAGG + Exonic
1083469464 11:62873353-62873375 TGGTGGGCCCCTGTAGTCCCAGG + Intronic
1084412504 11:69012846-69012868 CCCTGGAACCCTGGAGCCTCAGG + Intronic
1084941769 11:72616914-72616936 GCCTGAGGCCCTGTAGCCCCTGG - Intronic
1085385120 11:76153155-76153177 CCCTGGGACCCTGTGCCCCAGGG + Intergenic
1089253039 11:117178966-117178988 ACCTGAGACCCTGGAGCCCCGGG - Exonic
1090029417 11:123194810-123194832 CCGGGTGTCCCTGCAGCCCCTGG - Intronic
1091704898 12:2687176-2687198 CCCAGGGACCCAGGAGCCCCAGG + Intronic
1094851323 12:34383573-34383595 GCGTGGGACCCAGTGGACCCTGG - Intergenic
1095954267 12:47797483-47797505 CTGTAGAACCCTGGAGCCCCTGG - Exonic
1104493908 12:129218981-129219003 CCGGGGAAACCTGTAACCCCAGG - Intronic
1104751958 12:131245509-131245531 CCCTGGGCCCCTGCAGCACCAGG - Intergenic
1104898533 12:132175833-132175855 CAGTGGGACCCGGCAGCCCTGGG - Intergenic
1113329471 13:109314618-109314640 TGGTGGGAGCCTGTAGTCCCAGG - Intergenic
1119147652 14:72331550-72331572 CAAAGGGACCCTGGAGCCCCAGG - Intronic
1122178686 14:99939139-99939161 CCATGTGGCCCTGTGGCCCCTGG + Intronic
1123110657 14:105865479-105865501 CTGTGGGTTTCTGTAGCCCCTGG - Intergenic
1126692340 15:51297388-51297410 CCATGGGACTCTGTCTCCCCCGG - Intronic
1132481257 16:167248-167270 CCCTGTGACCCTGCAGCCCTGGG + Intergenic
1132806531 16:1777613-1777635 CCCTGGGACCCTGGGGCCTCAGG + Intronic
1133052321 16:3124231-3124253 CCATGGGACCCTGCAGGCTCTGG - Intergenic
1135673042 16:24391143-24391165 TCGTGGGTGCCTGTAGTCCCAGG + Intergenic
1138270178 16:55690488-55690510 CCCTGGAACTATGTAGCCCCAGG - Intronic
1138588916 16:57988805-57988827 CTGTGGGTCCCTGAAGCCCCAGG - Intergenic
1139749494 16:69100642-69100664 CCGTGGGACGATGGAGCACCTGG + Intergenic
1140116378 16:72045006-72045028 CCGTGGGACCCTGTAGCCCCTGG + Intronic
1142264747 16:89058519-89058541 CCTTCTGACCCTGCAGCCCCAGG - Intergenic
1150136979 17:62701464-62701486 GCGTGGGACTGTGGAGCCCCTGG - Exonic
1152281510 17:79387490-79387512 CGGTGGGACCCTGTGGGCCCTGG - Intronic
1152661387 17:81543923-81543945 GCATGGGACCCTGTAGCTGCTGG - Intronic
1152790350 17:82275267-82275289 CAGTGGTACCCTGGAGCCCTGGG + Intergenic
1154940721 18:21111093-21111115 CTGTGGGTCGCTGTTGCCCCCGG - Exonic
1159915258 18:74182579-74182601 CCGCGGGACCCTCCAGCCCTGGG + Intergenic
1160183933 18:76660318-76660340 CTGTGGGACCCTGTTTCCCAGGG - Intergenic
1160624048 18:80190779-80190801 CTGTGAGGCCCTGCAGCCCCTGG + Intronic
1160957821 19:1701740-1701762 CAGTGGGACCCTGGAGCCTCAGG + Intergenic
1161578068 19:5065785-5065807 CCATGGGCCCCAGAAGCCCCCGG - Intronic
1164137147 19:22426139-22426161 CCCAGGGACCCTGTAATCCCTGG - Intronic
1164161040 19:22625495-22625517 CCCAGGGACCCTGTAATCCCCGG + Intergenic
1167320762 19:48796106-48796128 CCGTGGGCCTCTGAGGCCCCTGG - Intronic
925971172 2:9107677-9107699 CCGTGGCTCCCTGCAGCCCAGGG - Intergenic
926192376 2:10738522-10738544 CCGTGGGTCCCTGAAGGACCGGG - Intronic
927864895 2:26582064-26582086 CAGAGGGACCCAGCAGCCCCGGG + Intronic
928939907 2:36717298-36717320 TGGTGGGAGCCTGTAGTCCCAGG - Intronic
930093965 2:47552475-47552497 CCCTGGGGCCCTGTAGAGCCTGG + Intronic
933775101 2:85766974-85766996 CCGAGGGGGCCTGAAGCCCCAGG + Intronic
934060781 2:88290929-88290951 CGGTGGGAGCCTGTAATCCCAGG + Intergenic
937454043 2:122025988-122026010 TCGTGGGCGCCTGTAGTCCCAGG + Intergenic
938583908 2:132670641-132670663 CCGCGGGAGCCTGGCGCCCCGGG + Intronic
946168531 2:217879841-217879863 CCATGGGACCCAGGGGCCCCAGG + Intronic
946330168 2:219004487-219004509 CTGAGGGGCCCTGAAGCCCCTGG + Intronic
948623822 2:239254147-239254169 CTGGGAAACCCTGTAGCCCCAGG + Intronic
948886548 2:240887850-240887872 CCTTGGGACCCTGTGTCCCCTGG - Intronic
1175399628 20:58693017-58693039 CCGCGGGAAGCTGCAGCCCCGGG + Exonic
1176145099 20:63562018-63562040 CTGTGGGTCCCTGTGGCCCAAGG + Intronic
1180007136 21:45028021-45028043 CCCTGGGCCCCAGAAGCCCCTGG + Intergenic
1180988069 22:19917281-19917303 CTGTGGGGCTCTGTATCCCCTGG - Intronic
1181115995 22:20632850-20632872 CCCTGGGATCCTGCAGCTCCTGG - Intergenic
1181433302 22:22895724-22895746 CCCTGGGATCCTGCAGCTCCAGG - Exonic
1181436825 22:22915962-22915984 CCCTGGGATCCTGCAGCTCCAGG - Intergenic
1181437666 22:22919888-22919910 CCCTGGGAACCTGCAGCTCCAGG - Intergenic
1181438314 22:22922943-22922965 CCCTGGGAACCTGCAGCTCCAGG - Intergenic
1181540974 22:23573214-23573236 CCCTGGGATCCTGCAGCTCCAGG + Exonic
1181550881 22:23638573-23638595 CCCTGGGATCCTGCAGCTCCAGG + Intergenic
1181797405 22:25320116-25320138 CCCTGGGATCCTGCAGCTCCAGG - Intergenic
1181834743 22:25594743-25594765 CGGTGGGCACCTGTAGTCCCAGG + Intronic
1183744434 22:39684928-39684950 ACGGGGGACCCTGCAGCCCGAGG - Intronic
1184174559 22:42780432-42780454 CTGTGGAACCATGTTGCCCCAGG + Intergenic
1184258663 22:43301964-43301986 CCATGAGGCCCTGCAGCCCCAGG + Intronic
1184872686 22:47251062-47251084 CCGGAGGCCCCTGTAGCTCCAGG + Intergenic
1185376125 22:50483390-50483412 GCGTGGGATGCTGTAGCCCCCGG + Exonic
950442728 3:13019377-13019399 CCGAGTGAGCCTGTTGCCCCTGG - Intronic
953887902 3:46728172-46728194 TGGTGGGCCCCTGTAGTCCCAGG - Intronic
956635684 3:71362302-71362324 CAGTGGGCACCTGTAGTCCCAGG - Intronic
964590613 3:158359622-158359644 CCTTGGGACCCTGCAGTTCCTGG - Intronic
964798773 3:160530000-160530022 TGGTGGGCGCCTGTAGCCCCAGG + Intronic
965683189 3:171273225-171273247 AGGTGGGTCCCTGTAGCTCCAGG - Intronic
975870959 4:78777138-78777160 GCATAGGACCCTGCAGCCCCTGG + Intronic
982765783 4:159346922-159346944 CGGCGGGAACCTGTAGTCCCTGG - Exonic
983204278 4:164896904-164896926 CCGTGAGTGCCTGTAGTCCCAGG - Exonic
984368875 4:178835203-178835225 CGGTGGGCACCTGTAGTCCCAGG + Intergenic
985005906 4:185535378-185535400 CCCTGAGAGCCTGAAGCCCCAGG + Exonic
985312412 4:188616705-188616727 TGGTGGGCACCTGTAGCCCCAGG - Intergenic
985786731 5:1899452-1899474 CCCTAGAACCCTGTGGCCCCAGG - Intergenic
986431998 5:7690753-7690775 CCTTGGGGCCCTGCAGCCTCTGG - Exonic
988421730 5:31014000-31014022 TGGTGGGCCCCTGTAGTCCCAGG - Intergenic
992275275 5:75110029-75110051 CAGTGGGACCCTGGAGCTCTTGG - Intronic
997699167 5:135884390-135884412 CCAGGGGACCCTGCAGTCCCAGG - Intronic
997735942 5:136212667-136212689 CCTTGGGAACCTGTGGCCCAGGG - Intergenic
1001158306 5:169292051-169292073 CTTGGGGACCCTGTAGGCCCTGG + Intronic
1001303647 5:170555864-170555886 CCTTGTGTCCCTGTAGCCCTAGG - Intronic
1002299083 5:178247525-178247547 CCTTGGGACCCTGGATTCCCTGG + Exonic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1007167849 6:39841217-39841239 CCCTGGAACCCTGCTGCCCCTGG - Intronic
1008063837 6:47026704-47026726 TCGGGGGACCTTGAAGCCCCTGG - Intronic
1013441742 6:110179062-110179084 CCGGGGGAGGCGGTAGCCCCGGG - Intronic
1018206506 6:161441764-161441786 TCCTGGGACCCTGAGGCCCCTGG - Intronic
1018735784 6:166686310-166686332 CTGTGGGACCCTCTGGCCCAGGG + Intronic
1019132085 6:169884362-169884384 CCGGGAGACCCTGAAGCACCTGG + Intergenic
1019547791 7:1586798-1586820 CCCTGGGAGGCTGGAGCCCCAGG + Intergenic
1019621797 7:1996142-1996164 CCGGGGGACCCTGCATGCCCAGG - Intronic
1024088225 7:45914761-45914783 CAGTGAGGCCCTGGAGCCCCAGG + Intronic
1029273290 7:99389817-99389839 CAGTGGGAGCCTGGAGTCCCTGG + Intronic
1029340921 7:99944024-99944046 CCTGGGTACCCTGTTGCCCCAGG - Intergenic
1036218834 8:6903611-6903633 CCCTGGGTCCCTGCTGCCCCTGG - Intergenic
1049710311 8:144060359-144060381 CCGCTGGACCCTGGAGCCCTCGG + Intronic
1049749006 8:144274771-144274793 CTGTGGGACCCTGCTGCCCCTGG - Intronic
1049802417 8:144524137-144524159 CCGAGAGGCCCTGCAGCCCCTGG - Exonic
1053403516 9:37849924-37849946 CCGTGTGTGCCTGTAGTCCCAGG + Intronic
1053559499 9:39175363-39175385 TGGTGGGAACCTGTAGTCCCAGG + Intronic
1053761647 9:41352821-41352843 CCCGGGGACCCTGTCGTCCCTGG - Intergenic
1054137614 9:61443580-61443602 TGGTGGGAACCTGTAGTCCCAGG - Intergenic
1054325361 9:63709915-63709937 CCCGGGGACCCTGTCGTCCCTGG + Intergenic
1054540240 9:66263939-66263961 CCCGGGGACCCTGTCGTCCCTGG - Intergenic
1059434952 9:114270593-114270615 CAGTGGGACCCTGGGGGCCCTGG - Intronic
1060403802 9:123362956-123362978 CTGTGGGCCCATGGAGCCCCGGG + Exonic
1060406667 9:123376278-123376300 GCCTGGGACTCTGTAGTCCCAGG - Intronic
1060843646 9:126816851-126816873 GGGTGGGACTCCGTAGCCCCAGG - Intronic
1060962076 9:127688118-127688140 TCTCGGGACCCTGTGGCCCCTGG - Intronic
1062460939 9:136662329-136662351 CCGTGGGTCCCTGAGGCCCATGG - Intronic
1062503150 9:136859799-136859821 CTGAGGGACCATGCAGCCCCAGG + Intronic
1062524711 9:136973541-136973563 CCCTGGGTCACTGTAGCACCAGG - Intergenic
1062688276 9:137827598-137827620 CTTGGGGTCCCTGTAGCCCCAGG - Intronic
1202791955 9_KI270719v1_random:94388-94410 CCCGGGGACCCTGTCGTCCCTGG + Intergenic
1189333480 X:40156477-40156499 CCGTGGGCCACTGGAGCCCGAGG + Intronic
1190735081 X:53250670-53250692 CCATGGGACCCTGAAGCACAAGG - Exonic
1192934327 X:75843511-75843533 TCGTGGGCTCCTGTAGTCCCAGG - Intergenic
1193023734 X:76821546-76821568 CGGTGGGATTCTGTAGCCCTAGG - Intergenic
1200163245 X:154019772-154019794 CCGGGGGAGCCCGCAGCCCCCGG - Exonic
1200830438 Y:7683873-7683895 ACGTGGGCCCTTGTTGCCCCAGG - Intergenic
1201152098 Y:11100072-11100094 CCCAGGGACCCTGGAGTCCCTGG - Intergenic