ID: 1140121016

View in Genome Browser
Species Human (GRCh38)
Location 16:72082956-72082978
Sequence GAGGAGATCTTCGGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140121016 Original CRISPR GAGGAGATCTTCGGGAAGGA AGG (reversed) Intronic
900078568 1:837504-837526 GAGGAGAGCTTCTGGAATGGTGG + Intergenic
900378836 1:2373725-2373747 GCTGAGATCTTCGGGAAGGCAGG - Intronic
900511528 1:3063166-3063188 GAGGAGAGTTCCGGGAAGGCCGG + Intergenic
901626839 1:10629550-10629572 GAGGGGATCTTCGGGGCTGATGG - Exonic
901762693 1:11480797-11480819 CAGGGGATCTTCTGGAGGGAGGG + Intronic
902045599 1:13521674-13521696 GAGGAGATCATGAGGAAGGAGGG - Intergenic
903446406 1:23424963-23424985 GAAGAGAGATTTGGGAAGGAGGG + Intergenic
903589652 1:24444979-24445001 TAGGAAATCCTCAGGAAGGAAGG + Intronic
903790173 1:25887370-25887392 GAGGAAAGCTTCGGGATTGAGGG - Intronic
904610470 1:31723256-31723278 GAGGAGGTGTTGGGGAAGTAGGG - Intergenic
905203999 1:36332494-36332516 GAGGAGATGTTAGGGAAGTGTGG - Intergenic
905797649 1:40824500-40824522 GAGGAGATGATGGGAAAGGATGG - Intronic
905800545 1:40839643-40839665 GAGGAGATCTTCTTGAAGAAGGG - Exonic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
907242047 1:53086305-53086327 GAGGAGGCCTCAGGGAAGGAAGG + Intergenic
907281787 1:53352050-53352072 GAGGGAATCTTCTGGAATGATGG - Intergenic
907281922 1:53353688-53353710 GAGGGAATCTTCTGGAATGATGG - Intergenic
907780145 1:57559432-57559454 GAGGTCCCCTTCGGGAAGGATGG - Intronic
909644866 1:77905662-77905684 GAGGAGGTTTTCAGGAAGGTGGG + Intronic
915482217 1:156194620-156194642 GAGGAGATGATCTCGAAGGAGGG + Intronic
916207650 1:162331060-162331082 GAGGAGATGTCCAGGAAGGTTGG + Intronic
916512204 1:165482356-165482378 GAGGAGTGCTGCGGGAAGAAAGG + Intergenic
916773203 1:167934396-167934418 GCAAAGATTTTCGGGAAGGAGGG - Intronic
917441022 1:175068997-175069019 GGAGAGATCTGGGGGAAGGATGG + Intronic
917675040 1:177310796-177310818 AAGTAGATATTAGGGAAGGAAGG - Intergenic
919241605 1:194923101-194923123 GAGGTCTTCTTGGGGAAGGATGG - Intergenic
920302923 1:205000427-205000449 GATGAGATTTGCAGGAAGGATGG - Intronic
920742688 1:208596464-208596486 TAGGTGATCTGCAGGAAGGAAGG + Intergenic
922234482 1:223712785-223712807 GAGGGGATGGCCGGGAAGGACGG - Exonic
923207599 1:231773954-231773976 GAGGAGATCTTGGGAATGTAAGG + Intronic
923524269 1:234760147-234760169 GCGCAGAACCTCGGGAAGGAGGG - Intergenic
923673047 1:236057425-236057447 GAGGAGGTTTTCAAGAAGGAGGG - Intronic
1067787310 10:49259963-49259985 GAGGACACCATAGGGAAGGATGG - Intergenic
1068837448 10:61570002-61570024 GAGGTGTCCTTGGGGAAGGATGG + Intergenic
1070395333 10:76007276-76007298 GAGGAGAGAATGGGGAAGGAGGG - Intronic
1070778003 10:79121346-79121368 GAGGGGCTCTCTGGGAAGGAGGG - Intronic
1071165867 10:82805595-82805617 GAGGAAATCTGCTGGAAGGTGGG + Intronic
1071937500 10:90547925-90547947 GAGGTGTACTTGGGGAAGGATGG - Intergenic
1074890810 10:117735374-117735396 GAGGAGATCTTTGAGAGGGCCGG + Intergenic
1075003403 10:118814039-118814061 GAGGAGATCTGGGGGTAGCAGGG - Intergenic
1075875343 10:125801346-125801368 GAGGAGATATCTGGGAAAGAAGG + Intronic
1076304794 10:129457959-129457981 GAGGTGGTGTTCGGGAAGGAAGG - Intergenic
1076865416 10:133164091-133164113 GAGGAGGGATTCGGGAAGGCAGG - Intronic
1079607155 11:22384502-22384524 GATGAGATCTGTGGGAAAGATGG - Intergenic
1080244955 11:30169353-30169375 GAGGGGATATTCAGGAAAGAAGG + Intergenic
1083301976 11:61744328-61744350 GAGGAGCTGAGCGGGAAGGAGGG - Exonic
1088828698 11:113517032-113517054 GGAGAGATATTAGGGAAGGAAGG - Intergenic
1089943110 11:122440261-122440283 GAGGAGATGTTTTGGAAGGCAGG + Intergenic
1089996598 11:122913717-122913739 CAGGAGATGTTCAGGAATGAGGG - Intronic
1091233190 11:134001658-134001680 GAGGAGCTCTTGGGGTAGGGGGG - Intergenic
1091239001 11:134039982-134040004 GATGAGCTCTTCCGGAAGGTGGG - Intergenic
1093036105 12:14333924-14333946 GAGGTGACCTTGGGGAAGAATGG - Intergenic
1094222325 12:28007793-28007815 GATGAGATCAACGGGAAGAAAGG - Intergenic
1096089574 12:48889970-48889992 GAGGAGCACTTTGGGCAGGAGGG - Intergenic
1096114984 12:49050455-49050477 GAGGAGAGCACTGGGAAGGAGGG + Exonic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1096431329 12:51545615-51545637 GAGGTGCTCTTCCAGAAGGAAGG - Intergenic
1097048051 12:56202365-56202387 CAGGAGAACTGGGGGAAGGAGGG - Exonic
1098656948 12:73044061-73044083 CAGGAGTTCATGGGGAAGGAGGG + Intergenic
1098855286 12:75645847-75645869 AAGGAGATCTTGGGGAAGGGGGG - Intergenic
1098994607 12:77104516-77104538 GAGTGCATCTTCTGGAAGGATGG - Intergenic
1099183992 12:79498088-79498110 GAGGTCTTCTTGGGGAAGGATGG + Intergenic
1101851906 12:108410031-108410053 GAGGACTTCTTAGGGAAGGACGG - Intergenic
1102000758 12:109556807-109556829 CAGGAGAGCTTGGGGAAGCAGGG + Exonic
1103004139 12:117408312-117408334 GAGCAGCTCCTGGGGAAGGAGGG - Intronic
1103035409 12:117652633-117652655 GAGGTGTCCTTGGGGAAGGATGG - Intronic
1103205434 12:119125252-119125274 ATGGAGAACTTCGGGAGGGATGG + Intronic
1106947805 13:34848177-34848199 GAAGAGCTCTTCAGGAAGGTGGG - Intergenic
1107534530 13:41315133-41315155 GAGAATATGTTGGGGAAGGAAGG + Intronic
1108156218 13:47587678-47587700 GAGGAAATCTTGGGGCATGATGG + Intergenic
1108372053 13:49779924-49779946 GAGGAGAGTTTCCTGAAGGAGGG - Intronic
1113037764 13:106070087-106070109 GAGGAGATGTGGGGGCAGGAGGG - Intergenic
1114896917 14:27002223-27002245 CAGGAGTTCCTAGGGAAGGAGGG + Intergenic
1115059513 14:29172483-29172505 GAGGTCTTCTTGGGGAAGGATGG - Intergenic
1117445467 14:55799933-55799955 GAGGAGTTGTTATGGAAGGAAGG - Intergenic
1121312868 14:92944581-92944603 GAAGAGAAGTTCTGGAAGGAGGG - Intronic
1122836470 14:104433208-104433230 GAGGAGGCCTTCAGGAAGGTGGG + Intergenic
1127841320 15:62834663-62834685 CAGGGGATCAACGGGAAGGATGG - Intronic
1128356632 15:66932155-66932177 GAGGTCATCCTAGGGAAGGAGGG + Intergenic
1128760609 15:70213941-70213963 CAGGAGATGTCTGGGAAGGATGG - Intergenic
1132324777 15:100959484-100959506 GAGGAGAATTTCGAGAAGCATGG + Intronic
1132499605 16:279662-279684 GAGGAGCTCTTTGGCAAGGGCGG + Intronic
1133404364 16:5511023-5511045 GAGGAGGTCCTTTGGAAGGAAGG + Intergenic
1133499564 16:6353170-6353192 GAGATGATCTTTGGGAAAGATGG - Intronic
1134325363 16:13202366-13202388 GCTGAGATCTACAGGAAGGAGGG - Intronic
1134387503 16:13787526-13787548 GTGGTTACCTTCGGGAAGGAGGG + Intergenic
1134461811 16:14436162-14436184 GTGGACATCTTCCTGAAGGAAGG + Exonic
1135424124 16:22323943-22323965 GCTGAGAGCTTCTGGAAGGATGG + Intronic
1137920395 16:52481930-52481952 GACGAGGTCTTAGGGCAGGAAGG + Intronic
1140121016 16:72082956-72082978 GAGGAGATCTTCGGGAAGGAAGG - Intronic
1140305879 16:73802247-73802269 GATGACCTCTTCAGGAAGGAGGG + Intergenic
1142123088 16:88396758-88396780 GAGGAGACCCTCGTGAAGGGAGG + Intergenic
1142467477 17:144602-144624 GCTGAGATCCTAGGGAAGGAAGG + Intergenic
1143529889 17:7496627-7496649 GCGGAGACTTTTGGGAAGGAGGG + Intronic
1144308685 17:13992670-13992692 AAGGAGTTCTTTGAGAAGGAGGG - Intergenic
1144312275 17:14024342-14024364 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1144332484 17:14236983-14237005 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1144498343 17:15764530-15764552 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1146482521 17:33216510-33216532 GAGGAGGTGTTAGGCAAGGAAGG + Intronic
1147452731 17:40515945-40515967 GAGGAGTGCTAAGGGAAGGATGG - Intergenic
1148559139 17:48596169-48596191 GGCGAGTTCCTCGGGAAGGAAGG + Exonic
1148900802 17:50875381-50875403 GAGGAGAAAGTAGGGAAGGAGGG - Intergenic
1150808425 17:68337225-68337247 GAAGAGATGTTCGGGAGGGGAGG + Intronic
1151767768 17:76140936-76140958 TAGGGGATCATTGGGAAGGAAGG + Intronic
1152750587 17:82060761-82060783 GAGGAGATATCCAGGCAGGAGGG - Exonic
1156470003 18:37371516-37371538 GAGGACATCTCTGGAAAGGAGGG - Intronic
1157983446 18:52409800-52409822 GAGGAGATTGTCAGGTAGGAAGG + Intronic
1158069589 18:53455134-53455156 GGGGAAGTCTTCAGGAAGGAAGG - Intronic
1159597400 18:70395514-70395536 GAGGAGGCCTTTGGGCAGGATGG + Intergenic
1159814017 18:73051675-73051697 GAGAAGATCTTCGGACAGCAAGG + Intergenic
1160361845 18:78290071-78290093 GAGGAGAGGTATGGGAAGGAGGG - Intergenic
1160375261 18:78406536-78406558 GAGGAGATAGCAGGGAAGGAAGG + Intergenic
1161400976 19:4066158-4066180 GAGGGGGGCTTCGGAAAGGAGGG - Intronic
1162305821 19:9872894-9872916 GAGTAGAGCTTGGGGAGGGATGG - Intronic
1162609924 19:11741317-11741339 GAGGATATCTTCGTGACAGAGGG - Intergenic
1162937824 19:13990323-13990345 GAGGGGATCTTTGGGAAAAAGGG + Intronic
1163026342 19:14514915-14514937 GAAGAAATCTTGGGGAGGGAAGG - Exonic
1163254011 19:16143893-16143915 GGGGAGAGCTTCGTGGAGGAGGG + Intronic
1164431867 19:28196005-28196027 GAGGAGATCAGAGGGAAGGAGGG - Intergenic
1166752192 19:45169640-45169662 GAGGAGAACCCCAGGAAGGAAGG + Intronic
1167273922 19:48523605-48523627 CATGAGAACTTCTGGAAGGATGG - Intergenic
928448823 2:31359707-31359729 GAGGAGATATTGGGGAAGACTGG + Intronic
928572163 2:32620492-32620514 GAGAAGTCCTTGGGGAAGGATGG + Intergenic
928748427 2:34442964-34442986 GAGCACCTCTTCAGGAAGGAGGG - Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
933902273 2:86858600-86858622 CAGGAGATCATCTGGAAGGGAGG + Intronic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
935087463 2:99862094-99862116 GATGAGGTCTTGGGGAAGGGTGG - Intronic
935778272 2:106490668-106490690 CAGGAGATCATCTGGAAGGCAGG - Intergenic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
936834202 2:116687279-116687301 AAGGACATCTTCTGGAAGCAGGG + Intergenic
939883065 2:147651795-147651817 GAGAAGAGCATCGCGAAGGAAGG + Intergenic
940277273 2:151952490-151952512 GAGGTGATCTCCAGGAAGGGTGG + Intronic
941717679 2:168780759-168780781 GAGGAGATCCTTAGGTAGGAAGG + Intergenic
942946684 2:181680968-181680990 GAGGGGATTTGAGGGAAGGAAGG + Intergenic
943104506 2:183527908-183527930 GAGAAGATCATCAAGAAGGAAGG + Intergenic
943718267 2:191175961-191175983 GAGGAGATGTTTGGGCAGCATGG + Intergenic
943786022 2:191880136-191880158 GAAGAAATCTTGGGGAGGGAGGG - Intergenic
944283861 2:197925744-197925766 GAGGAGGTCTGAGGGAGGGAGGG - Intronic
945446020 2:209939566-209939588 GAGGAGGTCTTCCTGAAGCATGG - Exonic
945790240 2:214295463-214295485 AAGGAGAGCTTAGGGAGGGAGGG - Intronic
946415778 2:219539037-219539059 GAAGAGTTGTTGGGGAAGGAGGG - Exonic
946504817 2:220287627-220287649 AAGGAAGTCTTCGGGGAGGATGG + Intergenic
1168754020 20:303381-303403 GAGGACATCTTAGGCATGGAAGG + Intergenic
1172063718 20:32205284-32205306 GGGGAGATGTTGGGAAAGGAAGG - Intronic
1172861861 20:38060595-38060617 GAGGATATCCAAGGGAAGGAAGG + Intronic
1173638889 20:44585111-44585133 GAGGTGATGTTCTGGAAGGAAGG + Intronic
1174755198 20:53151511-53151533 GATAATATCTTCAGGAAGGAAGG + Intronic
1177080174 21:16630104-16630126 GAGGAGATAATGGGGAAGGGGGG - Intergenic
1178376332 21:32070639-32070661 GAGAAGCTTTTCGGGAGGGAAGG - Intergenic
1179627198 21:42655390-42655412 GAGGAGAGCTTCAGGAGGGGTGG + Intronic
1181412177 22:22731635-22731657 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1181582857 22:23837555-23837577 GAGGAGAACTCCAGCAAGGATGG + Intronic
1182709139 22:32309817-32309839 GGGGTGACCTGCGGGAAGGAGGG + Intergenic
1183026871 22:35071864-35071886 GAGGAGGGCTACGGAAAGGAGGG - Intronic
1183209698 22:36443321-36443343 AAGGAGAACTTTGGGAGGGAGGG - Intergenic
1183326562 22:37197804-37197826 GAGGAGATCGTCAGAAAGGCTGG - Intronic
1183522461 22:38303366-38303388 GAGGAGCTCTTGGGGGAGGCTGG + Intronic
1183525363 22:38319387-38319409 GAGGAGGGCTTTGGGAAGCAGGG - Intronic
1183648596 22:39140924-39140946 GAGGACCTCTTAGGGCAGGAAGG - Intronic
1183928834 22:41224751-41224773 CAGTAGATCTTCCGGAAGGTGGG - Exonic
1184636052 22:45832464-45832486 GAGGACAACTTGGGGAAAGAGGG - Intronic
1184822338 22:46918585-46918607 GGGGACAACTTCAGGAAGGAGGG + Intronic
1184832784 22:47000282-47000304 GGGGAGGTCTTGGGGATGGAGGG + Intronic
949106381 3:204764-204786 GAGGCAATCTTCTGAAAGGATGG - Intronic
951850167 3:27130284-27130306 TAGGAGATGTTTGGGAAGCATGG - Intronic
952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG + Intergenic
953414341 3:42707068-42707090 GAGGTGATCTTGAGGAAGGATGG + Intronic
954072190 3:48151073-48151095 GAGGAGTCCTTGGGGGAGGATGG + Intergenic
954673681 3:52304047-52304069 GAGGACATAATCTGGAAGGAGGG - Intergenic
960926893 3:122803310-122803332 GAGAAGAGCTTCAGGAAGGTAGG + Intronic
961556521 3:127699988-127700010 GAGGAGATTGCAGGGAAGGAGGG - Intronic
963478674 3:145839793-145839815 CAGGTGATCATCGGAAAGGAGGG - Intergenic
964727915 3:159833977-159833999 GAGGAGATCATGGGAATGGAAGG - Intronic
964977395 3:162637200-162637222 GAGGTCATCTTGGGGAAGGATGG + Intergenic
965079879 3:164021835-164021857 GAGGAGATGTTAGGGAAGTGTGG + Intergenic
965910224 3:173765898-173765920 GAGGAGATGGTAGGGAATGAGGG - Intronic
967831575 3:193924568-193924590 GAGGTGTCCTTAGGGAAGGATGG - Intergenic
970617457 4:17781442-17781464 GCGGAGACCTTCGGGAAGCTGGG - Exonic
973532097 4:51844131-51844153 GAGGAGCTAGTCGGGGAGGAAGG + Intronic
975849885 4:78561240-78561262 GAGGAAGTGTTCGGGAGGGAAGG - Intronic
978220179 4:106262749-106262771 GAGGATATCTGTGTGAAGGATGG - Intronic
978899268 4:113928259-113928281 GAGGTCTTCTTGGGGAAGGATGG + Intronic
980158376 4:129132939-129132961 GAGCAGGTCTTATGGAAGGAAGG + Intergenic
980183116 4:129426502-129426524 GAGGAAAGCTTCCAGAAGGAAGG + Intergenic
981222639 4:142254575-142254597 GAGGAGATCAACTGGAAGAAAGG + Intronic
981462600 4:145030375-145030397 GAGGTCTTCTTGGGGAAGGATGG - Intronic
985122438 4:186657519-186657541 GAGGAGACCTTTGGGAATGATGG + Intronic
987021078 5:13872146-13872168 GAGGAGATCTGAGGGGAGGGGGG - Intronic
988126485 5:27045653-27045675 GAGCATTTCTTAGGGAAGGAAGG - Intronic
989373219 5:40731819-40731841 GAGGAGGTCTTCATGAAGAACGG - Intronic
991014012 5:61912328-61912350 GAGGTCTCCTTCGGGAAGGATGG + Intergenic
991353783 5:65747255-65747277 GAGGAGAAATTCGGGGAGGCTGG + Intronic
991509456 5:67360687-67360709 GGGGAGAGCTTCAAGAAGGAAGG + Intergenic
999219962 5:149967351-149967373 GAGGAGATTTTGGGGATTGATGG - Intronic
999229695 5:150054362-150054384 GAGCAGATCTGCTGGAAGGTGGG + Exonic
1000112794 5:158125197-158125219 GAGGAGAAAGTGGGGAAGGAAGG + Intergenic
1002683331 5:180986919-180986941 GAGGAGATATTGGGGAAGACTGG - Intergenic
1004022394 6:11787464-11787486 GAGGAGATGTTAGGGAAGTGTGG - Intronic
1004174539 6:13328419-13328441 GACGAGTCCTGCGGGAAGGAGGG + Intronic
1006643506 6:35500561-35500583 GAGGAGAGTTTCTGAAAGGAAGG + Intronic
1010789924 6:80053144-80053166 GAGGAGATCAACTGGAAGAAAGG - Intergenic
1010814936 6:80346884-80346906 GAGGAAATCTTCTGGAACTATGG - Intergenic
1010892734 6:81334422-81334444 GAGTAGATCATCTGGAAAGAAGG + Intergenic
1011329347 6:86186584-86186606 GAAGGGATCTTCAAGAAGGAGGG - Intergenic
1014818455 6:125959590-125959612 GAGAAGAACTTGGGAAAGGAAGG + Intronic
1015707965 6:136108915-136108937 GAAGAGAGATTCAGGAAGGAAGG - Intronic
1016419809 6:143872102-143872124 GAGGTCTTCTTGGGGAAGGATGG + Intronic
1022468809 7:30669229-30669251 AAGGAGGTCTTCCTGAAGGAAGG - Intronic
1022799646 7:33763809-33763831 GAGGAGGTCTGCGGAATGGATGG + Intergenic
1023045917 7:36210002-36210024 GAGGAGGTCTCGGGGGAGGATGG + Intronic
1023129515 7:36988253-36988275 GAGGAGATGTTCCAGAAAGATGG - Intronic
1024040079 7:45546122-45546144 GAGGTCTTCTTGGGGAAGGATGG + Intergenic
1029248316 7:99218470-99218492 GGGGAGTACTTCAGGAAGGAGGG + Intergenic
1032153305 7:129448364-129448386 GAGGTCTTCTTGGGGAAGGATGG + Intronic
1032704877 7:134413160-134413182 GAGGAGAACTTGGGGAAGCAGGG + Intergenic
1033115520 7:138621175-138621197 GAGGAGGGCTCGGGGAAGGACGG - Intronic
1033712110 7:143958400-143958422 GAGGAAATGTTGGAGAAGGAAGG + Intergenic
1035527075 8:322241-322263 GAGGAGAGCTTCTGGAATGGTGG - Intergenic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1037908019 8:22726853-22726875 GAGGGGAGCTGGGGGAAGGATGG + Intronic
1038055739 8:23856034-23856056 GAGGACTTCTTAGGGTAGGAAGG + Intergenic
1044095375 8:88057435-88057457 GAAGAGGACTTGGGGAAGGAGGG - Intronic
1044759954 8:95507399-95507421 GAAGAGCTCCTGGGGAAGGATGG + Intergenic
1045490482 8:102664795-102664817 GAGACGATCTTCCAGAAGGAGGG + Intergenic
1048019264 8:130523364-130523386 GAGGAGATGCTCAAGAAGGAAGG - Intergenic
1049582547 8:143419351-143419373 AAGGAGGTCTGGGGGAAGGAAGG + Intronic
1049684144 8:143932554-143932576 GAGGAGTTCTGTGGGCAGGAGGG + Exonic
1052139461 9:24961121-24961143 CAGGAGTTCGTAGGGAAGGAGGG + Intergenic
1052768209 9:32662929-32662951 GAGGAGAGTTTTGGGAAGGTGGG - Intergenic
1056242899 9:84667762-84667784 GAGGAACACTTGGGGAAGGAAGG - Intergenic
1056278402 9:85015760-85015782 AAGGAGACCTTTGGGAAGTAGGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058050448 9:100401215-100401237 GAGGAGGTCTAAGGGAAGGGGGG - Intergenic
1062696005 9:137876990-137877012 GGGGAGACCTTCGGGAACAAGGG - Intergenic
1203779313 EBV:92048-92070 GAGGAGCTCATGGGGAATGATGG - Intergenic
1187483249 X:19677590-19677612 GAGAAGATATTTGGGGAGGAAGG - Intronic
1190024619 X:46912370-46912392 GAGGAGAGGTTGGGGGAGGAAGG + Intronic
1191988373 X:67006057-67006079 GAGGTCTTCTTGGGGAAGGATGG + Intergenic
1192140125 X:68639698-68639720 GAGGAAAGCTGAGGGAAGGAAGG + Intergenic
1195045633 X:101052085-101052107 GAGGAGAACTTAGAGAAGGAAGG - Intronic
1195176203 X:102317620-102317642 GAGGAGAGCTTCGGAATGGGGGG + Intronic
1195182661 X:102369473-102369495 GAGGAGAGCTTCGGAATGGGGGG - Intronic
1197097274 X:122611414-122611436 GAGGTCTTCTTGGGGAAGGATGG - Intergenic
1198933820 X:141886425-141886447 GAGGTGTCCTTGGGGAAGGATGG - Intronic
1199022473 X:142898057-142898079 GAAGAGATCATGGAGAAGGAGGG + Intergenic
1200303249 X:154999593-154999615 GAGGAAATCTGCGTGAAGAAAGG + Exonic