ID: 1140123649

View in Genome Browser
Species Human (GRCh38)
Location 16:72103660-72103682
Sequence ACGCAGTACCTGCATGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140123649 Original CRISPR ACGCAGTACCTGCATGAAGA TGG Exonic
901689605 1:10964119-10964141 ACCCATTACCTGGATGAACATGG + Exonic
902706555 1:18209413-18209435 ACCCAATACCTGCATACAGAGGG + Intronic
903931269 1:26863862-26863884 TCGCAGCAGCTGCATGATGAGGG - Exonic
904496865 1:30892041-30892063 ACGCAGGACCTGCAGGAGGCTGG - Intronic
904558512 1:31381232-31381254 ACACAATACCTGCATGAACTTGG + Intergenic
905540932 1:38760021-38760043 AGGCATTGCCTGCATCAAGAGGG - Intergenic
907537025 1:55172026-55172048 TAACAGTAGCTGCATGAAGAAGG - Intronic
910811679 1:91243758-91243780 ACCCATTACATGCATGCAGATGG + Intergenic
919101223 1:193099661-193099683 AAGCAGTACCTTCAAGATGAAGG + Intronic
921740815 1:218682343-218682365 ACGCACCACCTACATGAAGTTGG + Intergenic
1064439619 10:15342060-15342082 ACCCAGGACCTGGATGCAGAAGG + Intronic
1064715019 10:18167630-18167652 ACTCAGTACCTGCATGATCGGGG + Intronic
1070388652 10:75949783-75949805 ACACAGTACCTGCAGATAGAAGG - Intronic
1073708304 10:106011553-106011575 ACGCAGCAGCTGCCTGAGGATGG + Intergenic
1075339298 10:121632844-121632866 ACGCAGTGCCTGCAGAATGAGGG - Intergenic
1076742141 10:132491319-132491341 ACACAGAACCTGCATGGACACGG + Intergenic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1084730467 11:71070068-71070090 ACGCAGTGCCTGCAGGACAAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1093729338 12:22549760-22549782 TTGCAGTACCAGCATGAATAAGG - Intergenic
1096568113 12:52498145-52498167 ACCCAGTACCAGCATGCACAGGG - Intergenic
1100067315 12:90664836-90664858 ACGGAATACCAGCATGTAGATGG - Intergenic
1101759128 12:107644826-107644848 ATGCAGTACATGGATGAAGCTGG + Intronic
1102215487 12:111158606-111158628 CCGGAGCATCTGCATGAAGATGG + Intronic
1103064738 12:117888038-117888060 ACCCAGTGCCTACCTGAAGAAGG + Intronic
1103862098 12:124023768-124023790 ATGCAGTTCCTACATGCAGACGG - Intronic
1106098365 13:26670560-26670582 AGCCAGTACCTTCATGAAGGCGG - Intronic
1113090317 13:106611223-106611245 AAGCAGTACATACATGAAAAAGG + Intergenic
1124067339 15:26356705-26356727 GGGCAGCACCTCCATGAAGATGG - Intergenic
1128390737 15:67180856-67180878 ACCCAGTACCTGGATGAACCTGG - Intronic
1130713191 15:86304545-86304567 ACACAGTCTCTGCATGAAGCAGG + Intronic
1135064322 16:19296501-19296523 ACCCAGTAACTCCATGAAGCAGG + Intronic
1140118394 16:72062552-72062574 AGGCAGTGCCTGCATGTTGAAGG - Intronic
1140123649 16:72103660-72103682 ACGCAGTACCTGCATGAAGATGG + Exonic
1141399271 16:83732945-83732967 ACTCACTGCCTACATGAAGAGGG + Intronic
1142987557 17:3705637-3705659 CCACAGGACCTGCATGAAGTAGG + Intergenic
1143243448 17:5463635-5463657 CCTCAGTACCTGTATGAAGGAGG - Exonic
1150021343 17:61616820-61616842 ATGCAGTGCCAGCATGAAAAAGG + Intergenic
1150722929 17:67628733-67628755 ACGCAGTGCCTGCAGCAGGAGGG + Intronic
1152064391 17:78102460-78102482 AGGCAGAACCTGCAACAAGAGGG - Exonic
1156228580 18:35132519-35132541 ACTCTGTACTTGCATGAAGAAGG - Intronic
1157211031 18:45742149-45742171 ACAAAGTACCTCCAGGAAGAAGG + Intronic
1160733006 19:649670-649692 ACGCTGTACCTGTGTGATGATGG + Exonic
1161034514 19:2077005-2077027 ACGGAGTGCCTGCAGGGAGAGGG + Exonic
1165141612 19:33703268-33703290 ACCCACTGCCAGCATGAAGAAGG + Intronic
1166948717 19:46412665-46412687 ACCCAGTTCCTGGAAGAAGAGGG - Exonic
926942016 2:18148374-18148396 AGACACTACCAGCATGAAGAAGG - Intronic
933501407 2:83116134-83116156 ATGCAGTTCCTTCATGAAGGAGG - Intergenic
933990453 2:87630101-87630123 ACGCAGCACCTGCATGGAGAAGG - Intergenic
936303393 2:111320723-111320745 ACGCAGCACCTGCATGGAGAAGG + Intergenic
942361978 2:175181744-175181766 CCGCAGCACCCGGATGAAGAAGG + Exonic
1179080177 21:38163450-38163472 AAGCACTGCCTGCATGACGAGGG - Intronic
1179238090 21:39564878-39564900 AAGCAATACCTGCCTGAGGAAGG - Intronic
1183270242 22:36857578-36857600 CCCCAGCACCTGCATGAGGAAGG + Intergenic
1183726075 22:39590344-39590366 AAGCTCTACCTGCAGGAAGAAGG - Intronic
1184476578 22:44725278-44725300 ACGGAGTACCTGCAGGTAGGTGG + Exonic
949361304 3:3234851-3234873 ATGCAATACCTGCATGAACTGGG - Intergenic
956233907 3:67045087-67045109 ACCAATTACCTGCATGCAGAGGG + Intergenic
958256004 3:91325557-91325579 AGGTTGTACCTGCATGAAGTTGG - Intergenic
958785280 3:98591209-98591231 AAGCAACACTTGCATGAAGATGG + Intronic
961476438 3:127149767-127149789 ACTCACTGCCTGCATGAAGAGGG - Intergenic
963836892 3:150067258-150067280 AAGCAGTACCTGGATGAGAACGG - Intergenic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
970905056 4:21205956-21205978 AGGCAGAACCTGAATGCAGATGG - Intronic
974387322 4:61218707-61218729 AAGCAGCACCTTCCTGAAGAAGG + Intronic
975899233 4:79130373-79130395 GCATAGTACCAGCATGAAGACGG - Intergenic
976537619 4:86236711-86236733 ACGCAGGTCCTGGTTGAAGAGGG + Intronic
980808084 4:137839112-137839134 ACACAGTACTGGCATGAAAATGG + Intergenic
981137007 4:141221283-141221305 ACGCAGTGCATGCAAGAAGTTGG + Intronic
981668030 4:147253124-147253146 ACGGGCTAACTGCATGAAGATGG - Intergenic
982843375 4:160220332-160220354 ACTCAGCACCTGCCTGAAAATGG + Intergenic
986029242 5:3880171-3880193 TCTCAGTAGCTCCATGAAGAGGG + Intergenic
989009983 5:36859089-36859111 ACACAGTAACTGGAGGAAGAAGG + Intergenic
995951782 5:117722892-117722914 ATGAAGTACTAGCATGAAGAAGG - Intergenic
996885637 5:128350773-128350795 ACGCAGTTCCTTAGTGAAGAAGG - Intronic
999516228 5:152304254-152304276 GCACAGTGCCTGCATGGAGAAGG + Intergenic
1000608311 5:163348327-163348349 AGGCTGTATCTGCATGAAGAGGG - Intergenic
1003852526 6:10239939-10239961 AGGCAGCACCTGCACAAAGAGGG + Intergenic
1004400868 6:15287662-15287684 AGGCAGCAACTGCAGGAAGAAGG - Intronic
1006475522 6:34250203-34250225 AAACGGTAGCTGCATGAAGAGGG - Intergenic
1008999334 6:57695615-57695637 AGGTTGTACCTGCATGAAGCTGG + Intergenic
1009187825 6:60595020-60595042 AGGTTGTACCTGCATGAAGCTGG + Intergenic
1014853312 6:126368224-126368246 AGGCAGTGCCTGCATCAGGAAGG + Intergenic
1023882615 7:44328959-44328981 ACACAGTAACTGCACAAAGAAGG - Intronic
1024821171 7:53331430-53331452 ATGCTGTACCAGCATTAAGATGG + Intergenic
1027712825 7:81629082-81629104 ACCCAGCACATGCATGAATATGG - Intergenic
1027839187 7:83286003-83286025 ATACAGTGCCTGCTTGAAGATGG + Intergenic
1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG + Intronic
1034764281 7:153703465-153703487 ACACAGTACCTGCATGTAAATGG + Intergenic
1035546914 8:488709-488731 ACACAGCACCTGGATGACGAGGG + Intergenic
1039540417 8:38363110-38363132 ACGCAGTACCTTCGTTAACACGG - Intronic
1047303566 8:123635490-123635512 CCGCACTATCTGCATGAGGAAGG - Intergenic
1049564468 8:143331079-143331101 ACGCATCACCTGCAAGAAGAGGG + Intronic
1049910909 9:266950-266972 ACACAGTACCTGCATGGAAACGG + Intronic
1051854781 9:21551578-21551600 AAGCAGTACCTGGGTTAAGAGGG - Intergenic
1056585475 9:87924867-87924889 ACGCGGGACCTGGAAGAAGAGGG + Intergenic
1056611405 9:88128076-88128098 ACGCGGGACCTGGAAGAAGAGGG - Intergenic
1061724206 9:132572600-132572622 AAGCAGAACCTGCATAAAAATGG - Exonic
1185487050 X:490052-490074 ACTTAGCACCTGCATGTAGATGG - Intergenic