ID: 1140124324

View in Genome Browser
Species Human (GRCh38)
Location 16:72107414-72107436
Sequence CTTGAGCAGCAGCACCACGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140124324_1140124334 29 Left 1140124324 16:72107414-72107436 CCAACGTGGTGCTGCTGCTCAAG 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1140124334 16:72107466-72107488 CCACTTCATGGACCCGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 91
1140124324_1140124328 -7 Left 1140124324 16:72107414-72107436 CCAACGTGGTGCTGCTGCTCAAG 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1140124328 16:72107430-72107452 GCTCAAGTCCCTCGGGGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 85
1140124324_1140124332 17 Left 1140124324 16:72107414-72107436 CCAACGTGGTGCTGCTGCTCAAG 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1140124332 16:72107454-72107476 CCTGCTGCAGTTCCACTTCATGG 0: 1
1: 0
2: 1
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140124324 Original CRISPR CTTGAGCAGCAGCACCACGT TGG (reversed) Exonic
900294482 1:1942084-1942106 CTTGGGCAGGAGCTCCAGGTGGG + Exonic
901759985 1:11464472-11464494 CATCAGCAGCAGCATCACCTCGG - Intergenic
904811413 1:33165492-33165514 CTTGAGCAGCTGCAGCGCTTCGG + Exonic
904915845 1:33970302-33970324 CTTGGGCACCATCACCACATGGG - Intronic
912508368 1:110172075-110172097 GATGATCAGCAGCACCAGGTAGG - Exonic
915221103 1:154375355-154375377 CATGAGCCACAGCACCAGGTGGG - Intergenic
916556527 1:165898647-165898669 TTTGAGCAGCAGCAAGACGCTGG + Intronic
916820476 1:168393383-168393405 CCTGAGCAGCAGAGCCACATGGG + Intergenic
922466581 1:225848963-225848985 GGTGAGCAGCAGCACCAGGAAGG + Exonic
924394819 1:243607317-243607339 CTTGAGCAGCACCACCCCTGTGG - Intronic
924741641 1:246797555-246797577 CTGGAGCAGCAGCACCCCCAGGG + Intergenic
1063352583 10:5368948-5368970 CCTCAGCATCAGCATCACGTGGG + Intronic
1065765432 10:29025428-29025450 CTTGTGCAACTGCACCACGTTGG - Intergenic
1067854913 10:49783850-49783872 CTGTAGCGGCAGCACCACCTGGG + Intergenic
1067911520 10:50351054-50351076 CTTGAGCAGCCCCACCCCTTTGG - Intronic
1069482537 10:68796894-68796916 CAATAGCAGCAGCAGCACGTGGG - Intergenic
1069748102 10:70728783-70728805 TTGGAGCAGCAGCAGCACCTGGG - Intronic
1069949832 10:72011182-72011204 CTGGAGCGCCAGCACCACGATGG + Exonic
1070609925 10:77926347-77926369 CTTGAGCAGCAGCTCCGCCTTGG + Exonic
1071470668 10:85981951-85981973 ATTGTGCAGCAGCACCAAGAAGG + Intronic
1077198417 11:1293139-1293161 CTGGAGCACCAGCAGCACGAGGG + Intronic
1079316386 11:19411187-19411209 CCAGAGCAGCAGCATCACCTGGG - Intronic
1082878901 11:58018463-58018485 CTGCAGCAGCAGCATCACCTGGG - Intergenic
1083683523 11:64362041-64362063 CTGGAACAGCAGCCCCACCTGGG - Intronic
1087790082 11:102396218-102396240 AAGGAGCAGCAGCACCACCTGGG - Intergenic
1089564526 11:119363858-119363880 GTTGAGCAGGAGCCCCACGAAGG + Intronic
1090623391 11:128583111-128583133 CTGCGGCATCAGCACCACGTGGG - Intronic
1090931129 11:131299069-131299091 CAGCAGCAGCAGCACCACCTGGG - Intergenic
1091274825 11:134342934-134342956 CTTGAACACCCTCACCACGTAGG + Exonic
1092652581 12:10650500-10650522 CTTGATCAGGAGCACAAAGTTGG - Intronic
1092813237 12:12290826-12290848 CCAGACCAGCAGCACCACCTAGG - Intergenic
1096363063 12:51004860-51004882 CTGGAGCAGCAGCCCCACAAGGG + Exonic
1097889017 12:64759115-64759137 CGTGAGGAGCAGCACCACGTTGG + Exonic
1098536862 12:71603119-71603141 ATTGCACAACAGCACCACGTGGG - Intergenic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1107195280 13:37643803-37643825 ATTTAGCAGTAGCACCAAGTGGG + Intronic
1108610933 13:52083166-52083188 TCTGTGCAGCAGAACCACGTAGG - Intronic
1110418115 13:75274213-75274235 CTTGAGCAGAAGCACAGCGATGG - Intergenic
1112057519 13:95704423-95704445 CTTCAGCAGCAGCACTAGTTAGG - Intronic
1118573007 14:67212989-67213011 CTGGACCAGCAGCATCACCTGGG + Intronic
1121577563 14:95000744-95000766 CTCGAGCTGCAGCACTACCTGGG + Intergenic
1121873054 14:97426888-97426910 CTTTAGAAGCAGCAGCACTTAGG + Intergenic
1123935385 15:25191584-25191606 CCTGAACAGCAGCATCTCGTGGG + Intergenic
1124531657 15:30513534-30513556 CCTCAGCATCAGCAACACGTGGG - Intergenic
1124767001 15:32494160-32494182 CCTCAGCATCAGCAACACGTGGG + Intergenic
1125833664 15:42733092-42733114 CTTGGGCAGCAGAATCAGGTGGG - Exonic
1132758330 16:1496655-1496677 CTGGAGCAGCACCACCACCACGG - Intronic
1134310772 16:13073474-13073496 CATCAGCAGCAGCATCACCTGGG + Intronic
1134402179 16:13920332-13920354 GTTGAGCACCAGCACCAGGCAGG - Exonic
1134630468 16:15752474-15752496 CTAGACCAGCAGCATCACCTGGG + Intronic
1135300138 16:21319674-21319696 TTTCAGCAGCAGCACCAGGCTGG - Intergenic
1135953116 16:26933859-26933881 CTTGACCAGCAGCACCAGCTAGG + Intergenic
1136269418 16:29139680-29139702 CCGCAGCAGCAGCAGCACGTTGG - Intergenic
1138009566 16:53365094-53365116 CCTCAGCATCAGCAACACGTGGG + Intergenic
1138340498 16:56286032-56286054 TTGAGGCAGCAGCACCACGTGGG + Intronic
1140124324 16:72107414-72107436 CTTGAGCAGCAGCACCACGTTGG - Exonic
1142228002 16:88886766-88886788 CTTGAGCAGCCACAGAACGTGGG - Intronic
1142911697 17:3098605-3098627 CTGGAGAAGCAGCAGCACGCTGG - Intergenic
1143409986 17:6702978-6703000 CTGGCCCAGGAGCACCACGTTGG + Exonic
1144394106 17:14826856-14826878 CATCAGCATCAGCACCACCTGGG + Intergenic
1146122664 17:30209213-30209235 CTCCAGCAGCTTCACCACGTAGG + Exonic
1147162965 17:38578658-38578680 CGTGTGCACCAGCCCCACGTTGG + Exonic
1147402829 17:40191368-40191390 CTGCAGCAGCAGCTCCAAGTTGG - Exonic
1151620372 17:75241297-75241319 CTTGTGCAACACCACCACGCTGG + Intronic
1152521157 17:80857812-80857834 CTGGAGCAGCTTCAGCACGTAGG - Exonic
1155012251 18:21791416-21791438 CCTGAGCAGCATCTCCACTTCGG - Exonic
1157427532 18:47596611-47596633 CATGAACAGCAGCATCACCTGGG + Intergenic
1163466621 19:17471571-17471593 CCTCAGGAACAGCACCACGTGGG + Intronic
1166767269 19:45259085-45259107 CCCGAGGAGCAGCCCCACGTGGG + Exonic
927494247 2:23541928-23541950 TTTGAGCAGCTGCACCACTACGG - Intronic
928164032 2:28956532-28956554 CAGCAGCAGCAGCATCACGTGGG - Intergenic
931640773 2:64379278-64379300 CTTGAGAAGCATCATCACTTTGG - Intergenic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
936811496 2:116408012-116408034 CTTGAGCAGCACCACCCCTGTGG - Intergenic
938784233 2:134610500-134610522 CATCAGCAGCAGCATCACTTGGG - Intronic
942231172 2:173862019-173862041 CAGCAGCATCAGCACCACGTGGG + Intergenic
947688789 2:232115456-232115478 CCTGAGAATCAGCTCCACGTGGG + Intronic
948277440 2:236719857-236719879 CTTGAGCAGCAGCACCAGGCAGG + Intergenic
949073157 2:242038966-242038988 CTAGAACAGCAGCTCCCCGTGGG - Intergenic
1169545296 20:6643960-6643982 CTTGAGCAGATCAACCACGTTGG - Intergenic
1169962266 20:11174504-11174526 CTTTGGCGGCAGAACCACGTAGG + Intergenic
1170284568 20:14692113-14692135 CTGGAGCAGCAGCATCACCTGGG + Intronic
1170493028 20:16897893-16897915 CTGTAGCAGCAGCATCACTTTGG + Intergenic
1170615399 20:17945009-17945031 CTTGAGCACCAGCAGAAGGTTGG - Intronic
1170672988 20:18452289-18452311 CTGCAGCATCAGCATCACGTGGG - Intronic
1172036418 20:32013934-32013956 CTGGACCAGCAGCACCACCTAGG - Intronic
1172853483 20:37983468-37983490 CTTGAGCAGCTGGAGCACGTTGG + Exonic
1173101300 20:40091369-40091391 CTTGAGCAGCATCACCCCTGTGG + Intergenic
1173245703 20:41336011-41336033 CTGGACCAGCAGCAGCACTTGGG - Intergenic
1173872438 20:46350460-46350482 CCGGAGCAGCAGCTCCAGGTCGG + Exonic
1179512707 21:41884482-41884504 CTGGAGCATCAGCACAAAGTGGG + Intergenic
1179834904 21:44024385-44024407 CTTCAGCATCAGCACCACCTGGG - Intronic
1180860226 22:19074915-19074937 CTTGTGCAGCTGCAGCACGTTGG - Intronic
949893299 3:8749327-8749349 CTTGGGCATCAGAACCAAGTGGG - Intronic
950117396 3:10460247-10460269 TTTCAGCACCAGGACCACGTGGG - Intronic
950978330 3:17274644-17274666 TTTGAGGAACAGCACCAGGTGGG - Intronic
952831106 3:37565801-37565823 CTAGACCAGCAGCATCACGTGGG - Intronic
952920528 3:38281048-38281070 CTTGAGCAGCAGCACTCTGGGGG - Intergenic
955969750 3:64426466-64426488 CTGGACCAGCAGCAACACCTGGG + Intronic
958158252 3:89783799-89783821 CTTGAGCAGCAGCATTAAGAAGG + Intergenic
964471058 3:157055937-157055959 CTTGAGGGGCAGCACCCAGTTGG - Intergenic
968881590 4:3302999-3303021 CTTCTGCAGCAGCTCCAGGTGGG - Intronic
985391989 4:189499724-189499746 CTTCAGCCTCAGCACCACGGTGG + Intergenic
986466923 5:8034994-8035016 CCTGAGCAGCAGCAGCACCAGGG + Intergenic
986486738 5:8245560-8245582 TTTGAGAAGCATCATCACGTGGG + Intergenic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
988070699 5:26284931-26284953 CTTGAGCAGCTCCACCACTGTGG + Intergenic
988491284 5:31707609-31707631 CTTTTGCAGTAGCTCCACGTGGG - Intronic
989437485 5:41431967-41431989 CTTGAGCAAGAGGACCACGCAGG + Intronic
991947748 5:71916243-71916265 GTTGGGAAGCAGCACCAAGTTGG - Intergenic
992879728 5:81095501-81095523 CTTGATCAGCAGCGCCAGTTGGG + Intronic
999239393 5:150118774-150118796 CTCGAGAAGCAGCACCAGCTGGG + Exonic
999377755 5:151098556-151098578 CTTAAGCACCAGAACCACATTGG + Intergenic
999730841 5:154475897-154475919 CTTTGGCAGCAGCAGCACGAAGG - Exonic
1000721063 5:164707821-164707843 CTTCAGCATCAGCATCACCTGGG + Intergenic
1002105415 5:176877408-176877430 CTTGGGCTGCAGGACCACGTGGG - Intronic
1004013462 6:11711127-11711149 CTTGAGGAGCAGCACCACAGGGG - Intergenic
1005994680 6:30924010-30924032 CAGCAGCAGCAGCACCACTTGGG - Intronic
1006371849 6:33649743-33649765 ATTGAGCAGCAGAACCATGTGGG + Intronic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1007281001 6:40712416-40712438 CTGGACCAGCATCACCAGGTGGG + Intergenic
1007704839 6:43784315-43784337 CCTGAGCAGCAGCTCCACTCAGG - Intronic
1009383683 6:63063490-63063512 CTTGAGCAGCTCCACCACTGTGG - Intergenic
1016380660 6:143475368-143475390 CATGAGCTGCTGCACCAGGTTGG - Intronic
1017909672 6:158782179-158782201 CCTGTGCAGTATCACCACGTGGG + Intronic
1017969649 6:159300950-159300972 GTTAAGCAGCAGAAGCACGTAGG - Intergenic
1017989105 6:159470887-159470909 CTTGAGCAGCACCACCGCCGTGG + Intergenic
1018033629 6:159863928-159863950 CCTGAGAAGCTGCACCACCTGGG + Intergenic
1018314814 6:162546382-162546404 CATGAGCTACAGCACCAGGTCGG + Intronic
1023058594 7:36309260-36309282 CTGGAGCAGCAGCACCCCCAGGG - Intergenic
1023710104 7:42982967-42982989 CCTGAGCAGCAGTACCATGGAGG + Intergenic
1023890479 7:44388595-44388617 CTTTAGCATCAGCACCAGGCAGG + Intronic
1028754561 7:94420534-94420556 GTTGACCAGCAGCACCCTGTTGG - Exonic
1029257780 7:99280963-99280985 CTAGAGGAGCTGCACCAGGTAGG + Intergenic
1031424080 7:121584742-121584764 ATAGAGCAGCAGCACTACCTGGG - Intergenic
1031964456 7:128017667-128017689 CTCCAGCAGCAGCACCACTCGGG + Intronic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1035574850 8:697790-697812 ATGCAGCAGCAGCAGCACGTGGG + Intronic
1041830160 8:62144449-62144471 CTTGCCCAGCAGCACGTCGTAGG - Intergenic
1042118365 8:65457528-65457550 CTTGAGAAGCAGCCTCACCTCGG - Intergenic
1043837008 8:85060073-85060095 CTTTAGCAGCAGAACCACATGGG - Intergenic
1045852904 8:106724535-106724557 CATCAGCAGCAGCAGCACCTGGG + Intronic
1046219719 8:111198354-111198376 CTAGAAGAGCAGCACTACGTTGG + Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049744961 8:144259385-144259407 CCTGAGCAGGAGCCCCACCTTGG - Intronic
1049791080 8:144473029-144473051 CTGCAGCAGCAGCACCGCGGTGG - Exonic
1052338854 9:27345693-27345715 CTTGAGCTACAGCAGCACCTAGG + Intronic
1056742094 9:89266273-89266295 CCAGAGCAGCAGCATCACCTGGG - Intergenic
1057508918 9:95661635-95661657 CTTGAGCAGCAGCAATATGCTGG - Intergenic
1059251347 9:112890304-112890326 CTTGAGCAGCAGCCCGAGGCGGG + Exonic
1061163168 9:128907541-128907563 CGTGTGCAGAAGCACCAGGTAGG - Exonic
1061503965 9:131020188-131020210 CTCGAGCATCAGAACCAGGTGGG + Intronic
1061591935 9:131603395-131603417 CTGGGGCAGCAGCATCACGAGGG + Intronic
1062342226 9:136098863-136098885 CCTGAACAGCAGCACCAGGGAGG - Intergenic
1185465597 X:352650-352672 CCTCAGCAGCACCATCACGTGGG - Intronic
1186486720 X:9939266-9939288 CTTGATCAGCAGCTCCGCCTTGG - Exonic
1186589880 X:10918759-10918781 CTGGACCAGCAGCATCACCTGGG + Intergenic
1190389974 X:49922457-49922479 CTTGCGCAGCCGCAGTACGTCGG - Intergenic
1193070789 X:77303613-77303635 CACCAGCAGCAGCACCACGTGGG - Intergenic
1194300649 X:92182099-92182121 CTTGTGCAGCTGCACCACTGTGG - Intronic
1198426052 X:136521277-136521299 CTGCAGCAGCAGCACCACCTGGG - Intergenic