ID: 1140124384

View in Genome Browser
Species Human (GRCh38)
Location 16:72107696-72107718
Sequence CACGATGAGCATCTTGGACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140124384_1140124387 -10 Left 1140124384 16:72107696-72107718 CCCTGTCCAAGATGCTCATCGTG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1140124387 16:72107709-72107731 GCTCATCGTGTCCTGTGACATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1140124384_1140124388 -9 Left 1140124384 16:72107696-72107718 CCCTGTCCAAGATGCTCATCGTG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1140124388 16:72107710-72107732 CTCATCGTGTCCTGTGACATGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140124384 Original CRISPR CACGATGAGCATCTTGGACA GGG (reversed) Exonic
905970993 1:42142330-42142352 CACCATGAGCACATCGGACAGGG + Intergenic
908834156 1:68211755-68211777 CACCATGTGGATCTTGGACATGG + Intronic
909194536 1:72601131-72601153 CACGATGAGGCTCATGGACAGGG - Intergenic
910710412 1:90174011-90174033 CACAATGAGGAGATTGGACAAGG - Intergenic
911244428 1:95501112-95501134 CACGCTGAGCAGCGGGGACAGGG - Intergenic
917716788 1:177746307-177746329 CATGATGAGCCTCTGGAACATGG - Intergenic
917758288 1:178126121-178126143 GAAGATAAGTATCTTGGACAAGG + Intronic
919970407 1:202573225-202573247 CACTGTAAGCATCTTGGCCATGG - Intronic
924100461 1:240597814-240597836 AAAGATGAGCAACTTGGGCATGG - Intronic
1063450749 10:6148426-6148448 CACGCTGAGCATAGGGGACATGG - Intronic
1067669239 10:48304673-48304695 CAAGATGGGAATCTTGGAAAAGG - Intergenic
1073673247 10:105615954-105615976 CACAATGAACATCTTGCCCAGGG + Intergenic
1074108861 10:110408574-110408596 CACGAGGAGCAGCTTCCACAGGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1086509783 11:87543906-87543928 CACTATCAGCATTTTGGTCAAGG + Intergenic
1095919300 12:47513552-47513574 CACTATCAGCATTTTGGTCAAGG - Intergenic
1098007919 12:66018888-66018910 CATGAGGAGCATCTTGGATCTGG + Intergenic
1102985227 12:117272490-117272512 CTCTAGGAGCATGTTGGACACGG + Exonic
1104357124 12:128097038-128097060 CACGATGTGCATCTTAGAAATGG - Intergenic
1106334190 13:28767684-28767706 CATCTTCAGCATCTTGGACAGGG - Intergenic
1106467554 13:30026344-30026366 CACGATGGTCATCTTAGTCAGGG + Intergenic
1107295974 13:38907780-38907802 CTGGATAAGCATGTTGGACAAGG + Intergenic
1111375303 13:87371065-87371087 GACGATGATCATTTTGGACCAGG + Intergenic
1112127437 13:96483693-96483715 AGAGATGAGCATCTTTGACAGGG + Intronic
1121048902 14:90807195-90807217 CAGGAGGAGGATCTTGGGCAGGG - Intronic
1124800197 15:32825130-32825152 AAAAATGAGCATCTTGGACCAGG - Intronic
1126038833 15:44571388-44571410 CACTATAAGCATCTAGGATATGG - Intronic
1126684835 15:51239722-51239744 CACGAGGAGCTTCTGGAACAAGG + Intronic
1129826408 15:78637779-78637801 CACTAGGAGCATCTTTCACAAGG - Intronic
1132638647 16:966756-966778 CTTGATGAGCAACTTGGCCAAGG + Intronic
1139172852 16:64651491-64651513 CACTATCAGCATTTTGGTCAAGG + Intergenic
1140124384 16:72107696-72107718 CACGATGAGCATCTTGGACAGGG - Exonic
1143518012 17:7429702-7429724 AAAGATGAGCAAGTTGGACACGG + Intergenic
1145358053 17:22181845-22181867 CACTATCAGCATTTTGGGCAAGG - Intergenic
1145957116 17:28862159-28862181 GATGATGAGCTTCTTGGAGATGG - Intergenic
1149913413 17:60586827-60586849 CCTGATGAGGACCTTGGACAGGG - Intergenic
1151835910 17:76582704-76582726 GAAGATGGGCATCTGGGACAGGG - Intronic
1152723307 17:81933306-81933328 CAAGAAGACCATCCTGGACAAGG - Exonic
1156391723 18:36657121-36657143 CACAAAGAGCTTCTTGCACATGG - Intronic
1160551414 18:79696024-79696046 CACGCTGTGCACCATGGACACGG - Exonic
1161301751 19:3546123-3546145 CTCCATGAGCTTCTTGGATAAGG - Exonic
1162327900 19:10009570-10009592 CGCGATCAGCACCATGGACAGGG - Intronic
1168569500 19:57453804-57453826 CACCATAACCATCATGGACAAGG - Intronic
925213688 2:2073599-2073621 CACGACGAGAAACTTGGACTAGG - Intronic
925240593 2:2322643-2322665 CACAAAGAGCATCGTGGAGAAGG + Intronic
925291853 2:2753151-2753173 CACTATCAGCATTTTGGTCAAGG - Intergenic
925383302 2:3443795-3443817 CTCGATGCGCATCTTGCACGCGG + Exonic
930720028 2:54629683-54629705 CTCGCTGAACATCTTGTACAGGG - Exonic
931251221 2:60531936-60531958 CACCATGAGCATCTGGGTTAAGG + Intronic
932366487 2:71156515-71156537 CACTAGGAGCATCTTTCACAAGG - Intergenic
935196023 2:100817389-100817411 CAGGATGAGCTTCTTGGAAGAGG - Intergenic
936814736 2:116445767-116445789 CACTATCAGCATTTTGGTCACGG + Intergenic
937078933 2:119126650-119126672 CACGGTGAGCACCCTGGGCATGG + Intergenic
937269454 2:120638856-120638878 CACAAAGAGCATATTGGACATGG - Intergenic
937379424 2:121363109-121363131 CATGAGGAGCAGTTTGGACATGG - Intronic
948401952 2:237691603-237691625 CACGCTGAGCTTCCTGGACGCGG - Intronic
948788313 2:240364570-240364592 CTCCATGAGCATGTTGCACACGG - Intergenic
948901824 2:240960153-240960175 CTCGATGGGCCTCTTGGCCAAGG - Intronic
1179277400 21:39904877-39904899 CAAGATGAGCCTCTTTGAAAAGG + Intronic
1180142996 21:45903776-45903798 CAAGATGAAGACCTTGGACAAGG - Intronic
1181050704 22:20237046-20237068 CAGGAAGAGCTTCTTGGAGAAGG + Intergenic
955671264 3:61405691-61405713 CATGAGCAGCATCTTGGAAAGGG - Intergenic
962281515 3:134055565-134055587 CACCATGACCATCTTTGAAAGGG - Intergenic
962957519 3:140279805-140279827 CCTGATCATCATCTTGGACAAGG - Intronic
962998467 3:140653718-140653740 CATGATGAGCTTCATGGACTTGG - Intergenic
965649401 3:170918450-170918472 CACTATCAGCATTTTGGTCAAGG - Intergenic
966146946 3:176823231-176823253 CAGGATGACCATCTTGCCCAGGG - Intergenic
966559568 3:181304908-181304930 CACTATGAGCATCTTTTACAAGG - Intergenic
970310529 4:14777774-14777796 CTGGATGAGTTTCTTGGACACGG - Intergenic
970344120 4:15136642-15136664 CACTATCAGCATTTTGGGCAAGG + Intergenic
971046378 4:22809783-22809805 CAAGTTCAGCATCTGGGACAGGG - Intergenic
971900395 4:32650744-32650766 CACTATCAGCATTTTGGTCAAGG + Intergenic
974390621 4:61262068-61262090 CATGATGAGCACCTTCAACATGG - Intronic
986149026 5:5109975-5109997 AACGATGAGCCTCTCCGACAGGG - Intergenic
988973665 5:36494143-36494165 GAAGATGAGCATCGTGGTCAAGG + Intergenic
991954663 5:71982381-71982403 TACATTGAGCATCTTGGACCTGG + Intergenic
992980007 5:82159451-82159473 CAAGATGAGCATGTTGGACTAGG + Intronic
1005842185 6:29750930-29750952 CATGAAGAGGATGTTGGACAGGG + Intergenic
1006339362 6:33438126-33438148 GACAATGAGCATCTTGCCCATGG + Exonic
1008949110 6:57135126-57135148 CACTCAGAGCATCTTGAACAAGG - Intronic
1012091576 6:94903662-94903684 CACCTTGATGATCTTGGACAAGG - Intergenic
1015112200 6:129605779-129605801 TAAGATGTGTATCTTGGACATGG - Intronic
1016244671 6:141967790-141967812 CACTATCAGCATATTGGTCAAGG + Intergenic
1019085101 6:169468193-169468215 CACTATCAGCATTTTGGTCAAGG + Intronic
1019133105 6:169891594-169891616 CACCGTGAGCCTCGTGGACAGGG + Intergenic
1019133126 6:169891744-169891766 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1019133145 6:169891894-169891916 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1019133174 6:169892074-169892096 CACCGTGAGCATTGTGGACAGGG + Intergenic
1019133193 6:169892194-169892216 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1019133226 6:169892404-169892426 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1019133231 6:169892434-169892456 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1019133324 6:169893070-169893092 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1019133329 6:169893100-169893122 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1019133346 6:169893220-169893242 CACTGTGAGCCTCGTGGACAGGG + Intergenic
1020515125 7:9107742-9107764 CACCTTGATTATCTTGGACAAGG - Intergenic
1021001906 7:15341479-15341501 CACTATCAGCATTTTGGTCAAGG + Intronic
1024474275 7:49793836-49793858 CAAGATCAGCATCCTGGACTGGG + Intronic
1030667978 7:112302676-112302698 CACTTTGAGCATCTTCAACAAGG + Intronic
1031283835 7:119840449-119840471 CACTATCAGCATTTTGGTCATGG - Intergenic
1031587334 7:123548026-123548048 TAAGATGAAAATCTTGGACAGGG + Intronic
1037681613 8:21102249-21102271 CCCGATGAGCAATTTAGACAGGG + Intergenic
1042577927 8:70241561-70241583 CAGGATGAACATAATGGACAAGG - Intronic
1046244327 8:111538929-111538951 CACTATAAGCATTTTGGTCACGG - Intergenic
1053925069 9:43046182-43046204 CACTATCAGCATTTTGGTCAAGG - Intergenic
1056531513 9:87492410-87492432 CATGCTGAGCATGATGGACAAGG + Intergenic
1060285432 9:122247542-122247564 CACCACCAGCTTCTTGGACAGGG + Exonic
1186086920 X:6000713-6000735 CACTATCAGCATTTTGGTCAAGG + Intronic
1187258020 X:17658893-17658915 CACAGTGAGCATATTGGTCAGGG + Intronic
1189339249 X:40192130-40192152 TAAGATGAGCATCTGGGATATGG - Intergenic
1201358946 Y:13125674-13125696 CATCATGAGCATCTTGAACCTGG + Intergenic