ID: 1140124403

View in Genome Browser
Species Human (GRCh38)
Location 16:72107793-72107815
Sequence GCCCAAGGTGGGGCAGCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 441}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140124395_1140124403 -5 Left 1140124395 16:72107775-72107797 CCCAGCCATCTTCTACAGGCCCA 0: 1
1: 0
2: 0
3: 9
4: 202
Right 1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG 0: 1
1: 0
2: 0
3: 36
4: 441
1140124391_1140124403 22 Left 1140124391 16:72107748-72107770 CCTGCTCATCGTTTCCATGCTCT 0: 1
1: 0
2: 2
3: 11
4: 137
Right 1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG 0: 1
1: 0
2: 0
3: 36
4: 441
1140124390_1140124403 29 Left 1140124390 16:72107741-72107763 CCGAGATCCTGCTCATCGTTTCC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG 0: 1
1: 0
2: 0
3: 36
4: 441
1140124398_1140124403 -10 Left 1140124398 16:72107780-72107802 CCATCTTCTACAGGCCCAAGGTG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG 0: 1
1: 0
2: 0
3: 36
4: 441
1140124393_1140124403 8 Left 1140124393 16:72107762-72107784 CCATGCTCTCGGTCCCAGCCATC 0: 1
1: 0
2: 2
3: 9
4: 228
Right 1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG 0: 1
1: 0
2: 0
3: 36
4: 441
1140124396_1140124403 -6 Left 1140124396 16:72107776-72107798 CCAGCCATCTTCTACAGGCCCAA 0: 1
1: 0
2: 0
3: 32
4: 175
Right 1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG 0: 1
1: 0
2: 0
3: 36
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140124403 Original CRISPR GCCCAAGGTGGGGCAGCGGC TGG Exonic
900299257 1:1968955-1968977 GCCCCAGGTGAGACAGCGCCTGG + Intronic
900345624 1:2209003-2209025 GGCCAGGGTGGAGCAGCTGCTGG - Intronic
900480125 1:2894180-2894202 GCTCATGGTGGAGCAGCCGCTGG - Intergenic
900617900 1:3573522-3573544 GCCCAGGCTGGGGCTGCTGCAGG + Intronic
900789079 1:4667362-4667384 CCCCACGGAGGGGCAGGGGCAGG - Intronic
901494665 1:9614109-9614131 GCCCAGGGTGGGACAGCGGAGGG - Exonic
901513795 1:9731690-9731712 GCCCACGGTGGGGTGGGGGCAGG + Intronic
902387363 1:16083493-16083515 GCCCCAGGAGGGGCTGGGGCTGG + Intergenic
902450010 1:16490982-16491004 TGCCAGGGTGGGGCAGGGGCAGG - Intergenic
902472190 1:16656846-16656868 TGCCAGGGTGGGGCAGAGGCAGG - Intergenic
902486613 1:16750600-16750622 TGCCAGGGTGGGGCAGAGGCAGG + Intronic
902579169 1:17397449-17397471 ACCCAGGGTGGGACAGGGGCAGG + Intronic
902607382 1:17576191-17576213 GCCCGGGGTGGGACAGGGGCAGG + Intronic
903130945 1:21279263-21279285 GACCCAGGTGGAGAAGCGGCTGG - Exonic
903830453 1:26171206-26171228 GAAGATGGTGGGGCAGCGGCGGG - Exonic
904478124 1:30777502-30777524 GCCCAGGGCAGGGCAGGGGCCGG + Intergenic
905038222 1:34930539-34930561 GGCCACGGTGGGGAAGCCGCAGG + Intergenic
905393521 1:37652982-37653004 GCCCAAGGAGAGGCAGGGGCAGG - Intergenic
906150131 1:43582797-43582819 GCCGAGGGTGGGGCCGGGGCAGG - Intronic
906658659 1:47567033-47567055 GCCCAAGGCTGGACATCGGCAGG - Intergenic
906660477 1:47578213-47578235 GGCGAGGGTGGGGCAGGGGCTGG - Intergenic
907276933 1:53321874-53321896 GCCCTAGGAGGGGCAGCGGATGG - Intronic
915101246 1:153502490-153502512 GCCCAAGTTGGGGCAGGGGATGG + Intergenic
915430088 1:155859845-155859867 GGCCAAGGGGGCCCAGCGGCAGG + Intronic
915445493 1:155972275-155972297 GCTCTAGGTGGGCCAGCAGCGGG + Intronic
916091334 1:161309901-161309923 GCCATAGCTGGGGCAGGGGCAGG + Exonic
916443092 1:164846709-164846731 GCCCCAGTTGGGGCAGGGGCAGG + Exonic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
918177155 1:182056733-182056755 GCCGCAGGTGGGGCAGGGGAAGG + Exonic
919809403 1:201399341-201399363 GCGCCAGGTGAGGCGGCGGCCGG - Exonic
919914307 1:202130337-202130359 GCCCAGGGATGGGCAGGGGCAGG + Exonic
920690978 1:208146070-208146092 GAAAAAGGTGGGGCAGGGGCTGG + Intronic
920920348 1:210292846-210292868 GCCTCAGGAGGGGCAGCGCCCGG + Intergenic
922219064 1:223544002-223544024 GTGCAAGGTGGGGCAGGGGCAGG - Intronic
922739406 1:228006956-228006978 GCGCCAGGTGGGCCGGCGGCCGG - Intergenic
1062830745 10:603947-603969 GCCAAGGGTGGGGCAGTGGTTGG - Intronic
1063130384 10:3172755-3172777 GCGCAATGTGGCGCTGCGGCGGG - Exonic
1063675585 10:8138493-8138515 GCGTAAGGTGGTGCAGAGGCCGG - Intergenic
1065215172 10:23440565-23440587 GCCCAAGACGGGGCATGGGCCGG + Exonic
1065753052 10:28906066-28906088 GCCCAAGCAGGGACAGTGGCCGG - Intergenic
1065901820 10:30214864-30214886 GCAGCAGGTGGGGCAGCGGGGGG - Intergenic
1066652856 10:37675474-37675496 GGGCAAGGTGGGGCAGCGGGAGG - Intergenic
1066961390 10:42230793-42230815 GGCCAAGGTGGGGCAGGGCTAGG + Intergenic
1066962610 10:42235480-42235502 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1067080887 10:43211641-43211663 GACCAAGGAGGGACAGCAGCAGG - Intronic
1067084220 10:43229621-43229643 GCCCCAGGTAGGGCTGCGGCGGG - Exonic
1067334438 10:45348499-45348521 CTCCTAGGTGGGGCGGCGGCTGG - Intergenic
1069626081 10:69868419-69868441 GCCCAGGGTGGGGCAGGGAGTGG + Intronic
1075105309 10:119536389-119536411 GCCCTGGGCGGGGCAGGGGCTGG - Intronic
1076024702 10:127101692-127101714 GCCCAAGGGGAGCCAGCAGCAGG + Intronic
1076428017 10:130381119-130381141 GTCCAAGGTGAGGCAGCATCCGG - Intergenic
1077141414 11:1026522-1026544 GCCCAGGGCTGGGCAGCAGCTGG - Intronic
1077211061 11:1371158-1371180 ACCCAGGGCTGGGCAGCGGCGGG + Intergenic
1077228682 11:1449236-1449258 GGCCAGGCTGGGGCAGCTGCTGG - Intronic
1077368995 11:2172830-2172852 TCCCTGGGTGGGGCAGCGGCTGG - Intergenic
1077470830 11:2759811-2759833 GCCCAGGGTGGAGGAGGGGCTGG - Intronic
1077535163 11:3120528-3120550 GCCCAAGGTGGGCCAGTGGGTGG - Exonic
1080844412 11:36014422-36014444 GCCCAAGGAATGGAAGCGGCTGG + Intronic
1081602731 11:44506448-44506470 GCCCAAGGTGGGCTAGGAGCAGG + Intergenic
1081811099 11:45914502-45914524 GCCCAGGCTGGGGCAGGGGAAGG + Intronic
1081911978 11:46705517-46705539 GCCACAGGTGGGGCAGCGGTAGG - Exonic
1082980224 11:59114257-59114279 GCAGAAGGTGGGGCAGAGGGAGG + Intronic
1083318856 11:61833001-61833023 ACCCAGAGTGGGGCAGGGGCAGG + Intronic
1083689109 11:64396047-64396069 GCACAAGGTGGGGGAGGGGCGGG - Intergenic
1084019311 11:66408609-66408631 GCCGATTGTGGGGCTGCGGCGGG - Intergenic
1084302093 11:68258614-68258636 GCCCAAGGCCGGGCAGCAGCTGG + Intergenic
1084415909 11:69032888-69032910 GTCCACGGTGGGCCAGGGGCTGG - Intergenic
1084687670 11:70706479-70706501 GCCCTGGCTGGGGCAGTGGCTGG + Intronic
1084859758 11:72010770-72010792 GCTGAAGGTGGGGCAGCTGGGGG - Exonic
1084981286 11:72830078-72830100 GCCCAGGGTGGGGCAGAGCAAGG + Intronic
1085121288 11:73969208-73969230 GCCAAAGGTGGGGCTGAGGAGGG - Intronic
1085279406 11:75320257-75320279 GCCCAAGGTGGGGAGGGGGCTGG + Intronic
1086753539 11:90529738-90529760 GGCCACAGTGGGGCAGGGGCAGG - Intergenic
1087195060 11:95296963-95296985 GCTCTAGGTGGGGCAGCAGAAGG - Intergenic
1088103194 11:106177001-106177023 GCCCAAGATGGGGGCGTGGCAGG - Intergenic
1088796543 11:113270452-113270474 GCGCAGGGTGGTGCAGCTGCTGG - Intronic
1089214103 11:116825349-116825371 GCGCCAGGTGGGCCAGAGGCAGG + Intergenic
1089320931 11:117626258-117626280 GACCAAGGTTGAGCAGGGGCAGG - Intronic
1089439004 11:118498887-118498909 GCCCAGGGTTGGGGAGAGGCAGG - Intronic
1089640439 11:119844256-119844278 GGACAGGGTGGGGCAGGGGCAGG - Intergenic
1089968298 11:122671966-122671988 ACCCATTCTGGGGCAGCGGCTGG - Intronic
1090456524 11:126855025-126855047 GCCCAGGGCAGGGCAGAGGCAGG + Intronic
1091218717 11:133918602-133918624 GCCCGCGGTGGGGCTGCGGGTGG + Intronic
1091474046 12:753977-753999 TCCCCAGGGGCGGCAGCGGCTGG - Exonic
1091894350 12:4089074-4089096 CCCCACGGTGGGTCAGTGGCCGG + Intergenic
1092184833 12:6471027-6471049 GCGCGGGGTGGGGCAGGGGCGGG - Intergenic
1093583174 12:20807328-20807350 GCCCCAGGTGAGGCAGCCTCTGG - Intergenic
1095738834 12:45586131-45586153 TTCCCAGATGGGGCAGCGGCCGG + Intergenic
1100611291 12:96194081-96194103 TCCCGAGGTGGGGAGGCGGCTGG - Intergenic
1101466765 12:104957864-104957886 GCCCGAGGTGGGGCAGGCGCGGG + Intronic
1102587521 12:113933521-113933543 GCCAAAGGAGGCCCAGCGGCCGG + Intronic
1102644636 12:114396184-114396206 GCCCGGGGTCGGGCAGCCGCGGG - Intronic
1103329494 12:120144337-120144359 GCTCTAGCTGGGGCAGCAGCAGG + Exonic
1103750016 12:123151716-123151738 GCCCCCGGTGGGGGAGCGCCTGG + Intergenic
1103976525 12:124706203-124706225 CCCTGAGGTGGGGCAGGGGCAGG - Intergenic
1104055389 12:125226273-125226295 GGCCAAGGTGGAGCTGGGGCTGG - Intronic
1104198787 12:126567314-126567336 GCCCACTGTGGGGCAGGGGGTGG - Intergenic
1104709984 12:130978967-130978989 GCCCAAGGCAGGGAAGTGGCGGG + Intronic
1105414175 13:20194162-20194184 GCCCGAGGTGGGGCGGGGGTTGG - Intergenic
1106406566 13:29479901-29479923 GCCCAAGGTCATCCAGCGGCTGG - Intronic
1108403858 13:50081122-50081144 TTCCAAGATGGGGCAGGGGCAGG - Intergenic
1110598296 13:77342466-77342488 GCACAGTGTGGGGCAGTGGCAGG - Intergenic
1110626498 13:77660764-77660786 TTCCCAGATGGGGCAGCGGCTGG + Intergenic
1112175539 13:97019964-97019986 GGCCAAGCTGGGGCAGGGGGAGG - Intergenic
1112433348 13:99372572-99372594 CACCAAGGTGGGGAAGCTGCTGG + Intronic
1113758895 13:112833910-112833932 GCCCAGGTGGGAGCAGCGGCTGG - Intronic
1114252937 14:20977113-20977135 GGCCAAGGTGGGGCAGGGTTAGG - Intergenic
1117623280 14:57609839-57609861 GCCTAATGTGGGGAAGCGGAGGG - Intronic
1119147648 14:72331535-72331557 GCCCCAGGTGAGGCAGCTCCCGG - Intronic
1119390887 14:74290251-74290273 GCCCAGGCTGGGTCAGAGGCAGG + Intronic
1119736531 14:76986173-76986195 GCCCAAGGTGGGGCATATGGTGG - Intergenic
1121002071 14:90458658-90458680 CCCCACAGTGGGGCAGAGGCAGG + Intergenic
1121221403 14:92288290-92288312 CCCCAAAGTGGGGCAGGGGCTGG - Intergenic
1122264609 14:100540801-100540823 GCACCAGCTAGGGCAGCGGCAGG - Intronic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122918941 14:104871703-104871725 GCCCAAGGAGCCGCAGCAGCAGG + Intronic
1202854838 14_GL000225v1_random:43721-43743 GCCTGTGGTGGGGCTGCGGCCGG + Intergenic
1202860586 14_GL000225v1_random:79119-79141 GTCCATGGTGGGGCTGGGGCCGG - Intergenic
1202929757 14_KI270725v1_random:26893-26915 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1123422547 15:20144351-20144373 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1123531775 15:21150891-21150913 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1123630264 15:22256274-22256296 GCCCAAGGTGTGGAGGGGGCTGG + Intergenic
1124349316 15:28943769-28943791 GCCCAAGGAGGGGCCAGGGCTGG - Intronic
1124655536 15:31503939-31503961 GCCCAGGATGGCGCAGCTGCCGG - Intronic
1125511102 15:40292854-40292876 GCACAGGGTGGGGCAGCTTCTGG - Intronic
1127647498 15:60973309-60973331 GCCCAAGGTGGCCCAGCTCCTGG + Intronic
1127734918 15:61831238-61831260 CCCCAGTGTGGGGCAGCCGCTGG + Intergenic
1128342454 15:66831919-66831941 GGCAAAGGTGGGGCAGCAGGTGG - Intergenic
1128550044 15:68592032-68592054 GCCCAAGGCTGGGCAGCATCAGG - Intronic
1129867600 15:78921518-78921540 GGCCAAGCTGCGGCAGAGGCAGG - Exonic
1131327197 15:91459413-91459435 CCCCAAGCTTGGGCAGAGGCTGG + Intergenic
1131399582 15:92113685-92113707 GCCCCAGATGGGGCAGCCTCCGG - Intronic
1131468189 15:92672606-92672628 GTCCCAGGTGGGGCAGTGCCTGG - Intronic
1131583716 15:93671485-93671507 GCCCCAGGTGGGACGGCTGCAGG - Intergenic
1132210715 15:100020229-100020251 GTCCAAAGTGGAGCAGCAGCGGG - Intronic
1132462399 16:61979-62001 GCCCAAGGTGCGGCTCCGACAGG - Exonic
1132620968 16:868187-868209 GCCCAGGGTGGGGCAGAGCATGG - Intronic
1132645901 16:999156-999178 ACCCCAGGTGGGGCAGCTCCCGG + Intergenic
1132694354 16:1195302-1195324 GCTCAGGGCGGGGCAGGGGCGGG + Intronic
1132851431 16:2026731-2026753 GCCCGAGGCGGGGCAGGGGGAGG - Intronic
1132898069 16:2238247-2238269 GCCTGCGGTGGGGCAGGGGCAGG - Intronic
1132931074 16:2459563-2459585 GCCCCTGGTGGGGCAGGGGACGG - Intergenic
1133569563 16:7027473-7027495 GCCCAAGGTCAGGCAGAGCCAGG + Intronic
1134016475 16:10891925-10891947 GTCCAAGCTGGGGCACTGGCTGG - Intronic
1134307883 16:13049715-13049737 GCCCAAGGAGGAGAAGCAGCAGG - Intronic
1135206857 16:20492007-20492029 CCCCAAGGTGGAGCTGCGACCGG + Intergenic
1135212028 16:20531625-20531647 CCCCAAGGTGGAGCTGCGACCGG - Intergenic
1135920614 16:26645818-26645840 CAGCAAGGTGGGGCAGCGGCGGG + Intergenic
1136227503 16:28868965-28868987 GCCTCAGCTGGGGCAGGGGCAGG - Intronic
1136500811 16:30668997-30669019 GCTGAGGGTGGGGCAGGGGCAGG - Intronic
1136718752 16:32303531-32303553 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1136773162 16:32858425-32858447 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1136837123 16:33509795-33509817 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1136862205 16:33711009-33711031 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1136897453 16:34003094-34003116 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1137665424 16:50246454-50246476 GCGCCAGCTGGGGCAGCGTCTGG - Intronic
1138563444 16:57815834-57815856 GCCTGAGGTGGGGGAGTGGCAGG - Intronic
1139652773 16:68370931-68370953 GTCCATGATGGGGTAGCGGCTGG + Exonic
1139938871 16:70590724-70590746 GCCCAAGGTTAGCCAGCAGCTGG + Intronic
1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1140915076 16:79485825-79485847 GCCCAGGGGCGGCCAGCGGCTGG + Intergenic
1141524705 16:84604046-84604068 GGCCGTGGTGGGGCAGCGGGAGG - Intronic
1141618749 16:85225300-85225322 GCCCAGGGTGGAGCTGGGGCTGG + Intergenic
1141951039 16:87339561-87339583 GTCCCAGGTAGGGCAGAGGCTGG - Intronic
1141972822 16:87494369-87494391 GCCCAAGGTGTGGAGGGGGCTGG - Intergenic
1142010660 16:87712101-87712123 GCCCAAGGTGGGGCTGGTGCAGG - Intronic
1142124372 16:88402842-88402864 GGCCAGGCTGGGGCAGCGGTTGG + Intergenic
1142146819 16:88496247-88496269 GCCCAGGATGTGACAGCGGCGGG + Intronic
1142319227 16:89370371-89370393 GCCCAGGGTGTGGCTGGGGCAGG - Intronic
1203007679 16_KI270728v1_random:214240-214262 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1203075585 16_KI270728v1_random:1120535-1120557 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1203123700 16_KI270728v1_random:1559192-1559214 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1203147300 16_KI270728v1_random:1810074-1810096 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1142593820 17:1019954-1019976 CCCCAAGGTGGGCCACAGGCAGG + Intronic
1143031897 17:3972632-3972654 AACCAAAGTGGGGCAGCAGCAGG - Intergenic
1143486792 17:7259775-7259797 AACCAAGGTGGGGCAGGGACAGG - Exonic
1144651148 17:17008022-17008044 GAGCAATGTGGGGCAGGGGCAGG - Intergenic
1144733277 17:17540769-17540791 GTCCAAGGTGGGGGAGCGAGGGG - Intronic
1145253910 17:21312306-21312328 GGCCAGGGAGGGGCAGTGGCAGG - Intronic
1145976842 17:28988744-28988766 GCTCCAAGTGGGGCAGTGGCTGG + Intronic
1146259990 17:31414900-31414922 GTCCAAGGTAGGGCAGCTCCAGG + Intronic
1146379982 17:32321239-32321261 GCCCAAGGTCGGGGAGGGGAGGG + Exonic
1147000467 17:37358924-37358946 GCCAAGGGAGGGGCGGCGGCAGG - Intronic
1147184789 17:38707201-38707223 GCCTGAGGTGGGGCAGAGGGAGG - Intronic
1147331720 17:39703240-39703262 GGCCAGTGTGGGGCTGCGGCTGG + Intronic
1147374347 17:40015186-40015208 GGCCTGGGTGGGGCAGCGGGAGG + Intergenic
1147722546 17:42547921-42547943 GCCCAAGGTCATGCAGCGGCCGG + Intergenic
1148111125 17:45145015-45145037 GCCCAGGTGGTGGCAGCGGCGGG - Intergenic
1148111855 17:45148933-45148955 GTCCAAGGGGGTGCAGCGGCAGG - Exonic
1148725109 17:49783532-49783554 TCCCAGGGTGGGGCTGCGGGTGG + Intronic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1151820514 17:76494319-76494341 GCCCAATGTGCAGCAGCTGCTGG + Intronic
1153474945 18:5489054-5489076 GCCCAAGGAGGAGCAGCAGCAGG - Exonic
1156457783 18:37304450-37304472 GCCCATGGTGGGGCAGTGGGTGG + Intronic
1157474448 18:48012356-48012378 ACGCAAGGTGGGGAAGAGGCTGG + Intergenic
1157494059 18:48142721-48142743 GGCCAAGGTGGGATAGTGGCAGG + Intronic
1157667378 18:49499203-49499225 CCCCAACGTGGGGCAGCTGCGGG - Intergenic
1160518230 18:79490093-79490115 GCCCACGGGGGGGCGGGGGCGGG - Intronic
1160681149 19:412174-412196 ACCCTGGGTGGGGCAGGGGCAGG + Intergenic
1160694743 19:478052-478074 GTCCAAGGTTGGGCAGTGACAGG - Intergenic
1160817391 19:1042453-1042475 GCCCGGGGTGGGGCAGTGCCAGG - Intronic
1160823164 19:1067569-1067591 GCTCATGCTGGGGCGGCGGCTGG + Intronic
1160856321 19:1219432-1219454 GGCCAGGGTGGGGCGGGGGCCGG + Intronic
1160955218 19:1688187-1688209 GGCCAAGGTGGGGCCCAGGCAGG + Intergenic
1161074022 19:2276303-2276325 GCGCACGGTGGCGCAGTGGCTGG - Exonic
1161219906 19:3113723-3113745 GACCCAGGGAGGGCAGCGGCAGG - Intronic
1161560680 19:4970899-4970921 GCTCAAGGAGGGGGAGCGCCCGG - Intronic
1161605820 19:5214345-5214367 GCACAAGGTGGGGCCCAGGCTGG - Exonic
1162794356 19:13078855-13078877 GGCCAAGGTGCAGCAGCGGGTGG + Intronic
1163129652 19:15264649-15264671 CACCAAGCTGGGCCAGCGGCGGG - Exonic
1163358366 19:16829619-16829641 GGCCGAGGTGGGGCTGGGGCCGG - Intronic
1163390333 19:17026802-17026824 GGCCAAGCTGGGGCAGCCCCGGG + Exonic
1163410415 19:17150484-17150506 GCCCAAGGAGTGGCAGGGCCAGG - Intronic
1163436923 19:17301438-17301460 GGTGGAGGTGGGGCAGCGGCTGG + Exonic
1163578310 19:18123395-18123417 GCCCAGGGAGGGGCCGGGGCTGG - Intronic
1165453873 19:35899974-35899996 TCCCAGGGCGGGGCAGAGGCAGG + Intronic
1165462643 19:35953163-35953185 GCCCAGGATGGGGCCGGGGCAGG - Intergenic
1166294761 19:41883409-41883431 GCCCAAGGAGGGGCGGCCGCTGG - Intronic
1166669927 19:44703712-44703734 GGCCCAGCTGGGGCAGAGGCGGG - Intronic
1166981986 19:46636279-46636301 CCCCAAGGTGGCGGGGCGGCGGG - Intergenic
1167321824 19:48801353-48801375 GGGCAAGATGGGGCAGGGGCAGG + Intronic
1167429029 19:49443670-49443692 GCCCAAGTTTTGGCAGCGGCGGG - Intergenic
1167513126 19:49907305-49907327 GCCCAAGGTGGGGGTGAGCCTGG + Intronic
1168113379 19:54207531-54207553 GGCCAGGGTGGGGCTGGGGCTGG + Exonic
1168246914 19:55117160-55117182 GCCCCAGGTGGCGCAGCAGAGGG + Intronic
1202704586 1_KI270713v1_random:13640-13662 TGCCAGGGTGGGGCAGAGGCAGG - Intergenic
925346580 2:3176128-3176150 TCCCAAGGTGGGGAAGCAGGAGG + Intergenic
926010225 2:9401000-9401022 GCCCATTGTGGAGCTGCGGCAGG - Intronic
926422905 2:12716775-12716797 GCCCGAGGACTGGCAGCGGCGGG + Intergenic
926541097 2:14182545-14182567 GCCCAAGGTGGAGCTGGGCCTGG + Intergenic
927567104 2:24123177-24123199 ACCCAAGGCGGGGCAGGGGGTGG + Exonic
928169413 2:28993782-28993804 GGCCTGGGTGGGGCAGTGGCTGG + Intronic
929539657 2:42810167-42810189 GCCCAGGCCGGGGAAGCGGCAGG - Intergenic
929775858 2:44930160-44930182 GCCCAGTGTGGGACTGCGGCTGG + Intergenic
929780916 2:44956293-44956315 CTCCAAGGTGTGGCAGCGTCAGG - Intergenic
929885326 2:45872843-45872865 GGGCATGGAGGGGCAGCGGCAGG + Intronic
930048219 2:47192624-47192646 GCCCACCGTGGAGCTGCGGCTGG - Intergenic
933954030 2:87352869-87352891 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
934274964 2:91567621-91567643 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
934460653 2:94212451-94212473 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
934552590 2:95271489-95271511 CCCCAAGGTGCGGAAGAGGCGGG - Intergenic
934980294 2:98833854-98833876 GCCCAGGGTAGGGGAGTGGCAGG - Intronic
935046907 2:99490427-99490449 CCCCAAGGCGGGGCAGGCGCGGG - Intergenic
935866468 2:107392559-107392581 GCCCACGGCGGGGTAGCCGCGGG - Intergenic
937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG + Intergenic
937270087 2:120644066-120644088 GCCCAAAGAGGGGCAGCATCGGG - Intergenic
938991325 2:136632839-136632861 GACCAATGGGGGGCAGTGGCTGG - Intergenic
941508509 2:166376467-166376489 GCCCAAGGTCGGGGAGGCGCTGG - Intergenic
942178255 2:173355267-173355289 GCCAAAGGCCGGACAGCGGCCGG + Intronic
944252454 2:197591641-197591663 GCCCACGGTGGTGGAGCGGGGGG + Intronic
944461342 2:199954142-199954164 GCCCATGCTGGAGCAGTGGCAGG + Intronic
946122270 2:217526495-217526517 GCTCTGGGTGGGGCAGTGGCAGG + Intronic
946747086 2:222856871-222856893 GCCCAAGGAGAGGGAGAGGCTGG - Intergenic
948454152 2:238097000-238097022 GCCCTAGGAGGGGCAGAGGGAGG + Intronic
948468409 2:238162996-238163018 GGCCAAGATGGGGCAGAGACTGG - Intronic
948975847 2:241463439-241463461 GCGCGAGGTGGAGCAGAGGCTGG + Exonic
949037151 2:241821131-241821153 GCCACAGCTGGGGCAGTGGCAGG - Intergenic
949048719 2:241885398-241885420 GCCCCAGGTGGGGAGGTGGCAGG + Intergenic
1169278610 20:4249307-4249329 GACCGAGGAGGGGCAGCGCCAGG + Intergenic
1170552463 20:17489529-17489551 GACCAAGGAGGGGCATCAGCAGG + Intergenic
1171057414 20:21920922-21920944 GCACAAGGTGGGGCACAGGCTGG + Intergenic
1172028853 20:31967976-31967998 GCCGAAGGGGGGGCAGCCCCCGG - Intergenic
1172055294 20:32150528-32150550 GTCCAAGGTGGGCCTGGGGCTGG + Intronic
1173145480 20:40520689-40520711 TCCCAAGGAGGGGCAACGTCTGG + Intergenic
1173741873 20:45407129-45407151 GGCCAAGGTGGGGGAGCTGACGG - Intronic
1173752381 20:45487490-45487512 GCAGCCGGTGGGGCAGCGGCTGG - Intergenic
1174858658 20:54069790-54069812 GCCCAGGGTGGAGCTGGGGCTGG + Intronic
1175867918 20:62191234-62191256 GGACAAGGTGTGGCAGCTGCAGG + Intronic
1175899388 20:62354056-62354078 AGCCAAGGTGGGGCTGGGGCAGG - Intronic
1175965206 20:62656912-62656934 GACGAAGGTGAGGCAGAGGCAGG - Exonic
1176045935 20:63092567-63092589 GCCCCACGTGGGGCAGCAGCCGG - Intergenic
1176056239 20:63150705-63150727 GCCTGAGGTGGGGCTGCGTCTGG + Intergenic
1176098883 20:63356151-63356173 GGCCAGGGTGGGGCAGGGGCAGG + Intronic
1176098937 20:63356281-63356303 GGCCAGGGTGGGGCAGGGCCAGG + Intronic
1176368747 21:6049799-6049821 CTCCAAGTGGGGGCAGCGGCGGG - Intergenic
1176591779 21:8655492-8655514 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1178196257 21:30348270-30348292 GCCCAGGGAGCGGCAGCTGCTGG + Intronic
1178198120 21:30371881-30371903 GCCCAGGGAGCGGCAGCTGCTGG + Exonic
1178200387 21:30396397-30396419 GCCCAGGGAGCGGCAGCTGCTGG - Exonic
1178587654 21:33883678-33883700 GCCCATGCTGGGGAGGCGGCAGG - Intronic
1178610113 21:34073094-34073116 GCGCAAGGCGGGGTCGCGGCCGG - Intergenic
1178764670 21:35438963-35438985 GACCAAGGTTGGGCAGAGGGTGG + Intronic
1179754772 21:43488743-43488765 CTCCAAGTGGGGGCAGCGGCGGG + Intergenic
1179801612 21:43813834-43813856 GCCCAAGGGGTGCCAGGGGCAGG - Intergenic
1180032912 21:45224488-45224510 GCCCTGGGTGGGGCAGCTGTGGG + Exonic
1180274626 22:10632604-10632626 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1180549105 22:16527548-16527570 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1181009439 22:20031976-20031998 GCTCATGGTGGGGCACCTGCTGG - Intronic
1181355593 22:22294304-22294326 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1181782407 22:25202603-25202625 CCCAAAGGAGGGGCAGAGGCTGG + Intronic
1182068363 22:27445973-27445995 GCCCAAGGTCGGGCGTGGGCTGG - Intergenic
1182296161 22:29312078-29312100 GCCCGAGCTGGGTCAGGGGCTGG - Intronic
1182548399 22:31088612-31088634 GCCCAGGCTGGGGCAGGGGATGG + Intronic
1183442648 22:37831900-37831922 GGGCAGGGTGGGGCAGTGGCAGG + Exonic
1183780344 22:39995189-39995211 GCTCAAGGAGGAGCAGCTGCGGG + Exonic
1183909011 22:41064592-41064614 GGCCAGGGTGGGGCTGGGGCTGG + Intergenic
1184162253 22:42703940-42703962 GCCCAGGGAGGGGCAGAGGTGGG - Intronic
1184775102 22:46619181-46619203 GGCCAAGGTCGGGCACGGGCTGG + Intronic
1184819955 22:46902974-46902996 GCCCGAGGAGGGGCAGCGTATGG + Intronic
1184923789 22:47623772-47623794 GCCCAAGGCCAGGCAGTGGCAGG + Intergenic
1185350314 22:50332866-50332888 GCCCATGGGGAGGCAGAGGCGGG - Intergenic
949539446 3:5020652-5020674 GACTGAGGTGGGGCAGTGGCAGG - Intergenic
949547238 3:5082628-5082650 GCCCCAGGAGGAGCAGCAGCAGG - Intergenic
949919010 3:8986945-8986967 GCCCAAGGTGGTGCTGTAGCTGG + Intronic
950200111 3:11036675-11036697 GGCCCATGTGGGGCAGTGGCAGG + Intronic
950388304 3:12677034-12677056 GCCCTTGGTGGGGCAGGGGGAGG - Intergenic
950534807 3:13572596-13572618 GCCCAAGGCTGTGCAGAGGCTGG + Intronic
950645186 3:14372837-14372859 CCCCAACGTGGGGCAGCTGGAGG - Intergenic
950679364 3:14574390-14574412 GCCCAAGGTGCGGCTCCGACAGG - Intergenic
950765917 3:15272943-15272965 GCACGAGGTGGGGCAGGGGTTGG - Intronic
951474156 3:23087461-23087483 GCCCATCGTGGGGTGGCGGCAGG - Intergenic
951494462 3:23311006-23311028 GCCCATCGTGGGGTGGCGGCAGG - Intronic
952898839 3:38096485-38096507 GCCAAACGTGGGACAGAGGCAGG + Intronic
953026482 3:39148160-39148182 GCCCAGGGTGGGGGATTGGCTGG - Intronic
954247032 3:49340113-49340135 GCTCGAGGTGGGGCAGGGGCGGG - Intronic
954691872 3:52399985-52400007 GCCCAAGGTGGGCCTGCTGAGGG - Intronic
955526137 3:59821662-59821684 GCACATGGTGGGGCATCAGCAGG - Intronic
960658125 3:120028713-120028735 GGCCATGGTGGGGCAGAGGTTGG + Intronic
961352906 3:126315442-126315464 GCCCCAGATGGGGGAGGGGCGGG + Intergenic
961558170 3:127710856-127710878 CCCCAAGGTGGAGCAGAGCCAGG - Intronic
961638573 3:128350259-128350281 GCCCAAGCTGTGCCAGAGGCAGG - Intronic
966815221 3:183884851-183884873 GGCCATGGTGGGGCAGAGGTTGG - Exonic
966863113 3:184241602-184241624 GGCCGAGGTGGGGCTGAGGCTGG - Exonic
968550950 4:1223149-1223171 GCCCAGGTTGGGGCAGAGGTCGG - Intronic
968626207 4:1627771-1627793 CCCCCAGGTGGGGCTGCTGCTGG - Intronic
968663874 4:1810318-1810340 GCCCCTGGTGGGGCAGCTTCAGG - Intergenic
968934901 4:3604819-3604841 ACCAGAGGTGGGGCAGCGGGGGG + Intergenic
968997104 4:3952626-3952648 GGCCAAGGTCAGGCTGCGGCTGG + Intergenic
969110199 4:4839693-4839715 GGACAAGGTGGGGCAGGGCCAGG - Intergenic
969327305 4:6451472-6451494 GCATGAGGTGGGGCAGGGGCAGG + Intronic
969518504 4:7662062-7662084 CCCCGAGGTTGGCCAGCGGCAGG - Intronic
969617610 4:8262677-8262699 GCCAAGTGTGGGGCAGCAGCGGG - Intergenic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
971375496 4:26052745-26052767 GCTCAGGGTGGGGCAGGGGTGGG - Intergenic
971792317 4:31185055-31185077 GCCCACGGCGGGGCGGAGGCTGG + Intergenic
975735074 4:77372990-77373012 TCCAGAGGTGGGGCAGCAGCTGG + Intronic
975762851 4:77635331-77635353 GCCCAACTTGGGGCAGCAGGGGG - Intergenic
977606895 4:98993570-98993592 GCCCACGGTGGGGCCGGGGGAGG + Intergenic
979310479 4:119197821-119197843 GCCCAAGGAGGGCGAGCTGCAGG + Intronic
980103649 4:128566399-128566421 GCCAAAGCTGGGGCAGTGGATGG + Intergenic
981628669 4:146791520-146791542 GCCCAAGGAGGGGGAGAGACAGG - Intronic
982259140 4:153479111-153479133 GCCCAAGGTGGGGCTGGAACGGG + Intronic
983193375 4:164778693-164778715 GCCCAAGGAGAGGAAGAGGCAGG + Intergenic
984289914 4:177781977-177781999 GCCCAGGGTGGGGGCGTGGCGGG + Intronic
984313152 4:178090589-178090611 GCACAGGATGGGGCAGTGGCAGG - Intergenic
984852551 4:184167025-184167047 GGCACAGGTGGGGCAGCTGCGGG - Intronic
985625203 5:982120-982142 GCTCGAGGTGGGGCTGAGGCAGG - Intergenic
988354136 5:30151247-30151269 GCCCAGGGTGGGGAAGCTGCTGG - Intergenic
990400296 5:55430357-55430379 GCCCCAGGAGTGGCAGCAGCAGG - Intronic
990941271 5:61205281-61205303 TTCCCAGATGGGGCAGCGGCCGG - Intergenic
993405393 5:87505679-87505701 GCCTAAGGTAGCCCAGCGGCTGG + Intergenic
994857687 5:105145241-105145263 GGCCAAGGTGGGGCGGGGGGTGG + Intergenic
996379022 5:122845461-122845483 GCCCAGGGCGCGGGAGCGGCCGG + Exonic
996493857 5:124130515-124130537 GCCCTTGGTGGGGCAGGGCCTGG - Intergenic
997618857 5:135272012-135272034 GCCCAAGGTGGGGGTGGGCCAGG + Intronic
997624052 5:135319699-135319721 GCCCACAGTGGGGCAGATGCAGG + Intronic
998467502 5:142357292-142357314 ACGCGAGCTGGGGCAGCGGCCGG - Intergenic
999765517 5:154737807-154737829 TCACAAGGAGGGGCAGGGGCGGG - Intronic
1000347957 5:160330439-160330461 GCCCATGGTGCGGAGGCGGCAGG - Intronic
1001020308 5:168177206-168177228 GACTAAGGTTGGGCAGCTGCTGG - Intronic
1001480959 5:172089024-172089046 GCTCAGGCTGGGGCAGTGGCCGG - Intronic
1002259419 5:177983514-177983536 GCCCAAGGTGGAGGAGGGGTAGG - Intergenic
1002284170 5:178151296-178151318 GCCCACGGAGGGGCTGGGGCGGG + Intronic
1003121089 6:3319491-3319513 GCACATTGTGGGGCAGAGGCGGG - Intronic
1004241690 6:13928840-13928862 GCCAAAGGTGGTGCAGGGGTGGG + Intronic
1004519335 6:16347114-16347136 GCCCACGGAGGGGCAGGGGGAGG - Intronic
1006152980 6:31999138-31999160 GCCCAAGGTGGTGGAGGAGCAGG + Exonic
1006159288 6:32031875-32031897 GCCCAAGGTGGTGGAGGAGCAGG + Exonic
1006163903 6:32053505-32053527 GCCCAAGGTGGTGCGGGTGCCGG - Intronic
1006333986 6:33411022-33411044 GCCAAAGCAGCGGCAGCGGCAGG - Exonic
1006396037 6:33788498-33788520 GCCTGAGGTGGGGCGCCGGCTGG - Exonic
1006502742 6:34468700-34468722 GCCCAAGCTGGGGAAGCTTCTGG - Intronic
1006840023 6:37022621-37022643 GGCCAAGGTGGGGCAGGTGGAGG - Intronic
1012251985 6:96990745-96990767 GCCCAAGCTGGGGTGGGGGCGGG + Intronic
1013291219 6:108720293-108720315 GTCCAAGGTGGGGCAACAGAGGG + Intergenic
1013367360 6:109446194-109446216 GGCCAAGGCGGAGCAGCTGCGGG + Exonic
1015808008 6:137131998-137132020 GCCGGATGTGGGGCAGAGGCTGG - Intergenic
1016118424 6:140317120-140317142 GCCCAAGGTGAGGCACAGTCGGG - Intergenic
1016243623 6:141958826-141958848 GCACAAGGTGAAGCAGCAGCAGG + Intergenic
1017672176 6:156778496-156778518 GCCCAAGATGGGGGAGCCGGCGG + Exonic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1018216091 6:161529310-161529332 GCCCCAGGTGAGGCAGCTGGAGG - Intronic
1018856340 6:167678153-167678175 GCCCAAGCTGGGGGCGTGGCTGG - Intergenic
1018986062 6:168638056-168638078 GGGCAGGGTGGGGCAGGGGCAGG - Intronic
1019111871 6:169723829-169723851 CCCGAAGGTGAGGAAGCGGCCGG - Exonic
1019158406 6:170053680-170053702 GCTCCAGCTGGGGCAGAGGCCGG + Intergenic
1019278175 7:186976-186998 TCCTGAGGTGGGGCAGAGGCGGG - Intergenic
1019339271 7:500889-500911 GCCCAAGCTGCGGCACTGGCAGG - Intronic
1019419850 7:945887-945909 GCCCAGGCTGGGGCACGGGCAGG + Intronic
1019435529 7:1020434-1020456 ACGCAAGATGGGGCAGCGGCTGG - Intronic
1019488228 7:1299201-1299223 TGCCAAGGTCGGGCAGCGGCTGG + Intergenic
1019528466 7:1492052-1492074 ACTCAAGGTGGGGCAGCCGCTGG + Intronic
1019641469 7:2105977-2105999 GCCATATGTGGGGCAGGGGCAGG - Intronic
1019711372 7:2519633-2519655 GACCCACGTGGGGCCGCGGCTGG - Intronic
1020000761 7:4754294-4754316 GGCCAAGGTCACGCAGCGGCGGG - Intronic
1020560517 7:9726059-9726081 GGCCAAGCTGGGGCAGCCCCGGG - Intergenic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1026896797 7:74014027-74014049 GGCCAAGCTGGGGCAGAGGGCGG + Intergenic
1028830506 7:95322678-95322700 GCCCAAGTTGGGGTAGGGGAGGG + Intronic
1029376146 7:100177936-100177958 GCCCCCGGAAGGGCAGCGGCGGG + Intronic
1029594626 7:101530750-101530772 GCCCCAGATGGGGCAGAGGAGGG - Intronic
1029608952 7:101616359-101616381 GCACAAGGCTGGGCAGGGGCTGG + Intronic
1031406718 7:121395922-121395944 GCCCACGCCGGGGCGGCGGCCGG + Intronic
1032525463 7:132576202-132576224 GCCCGCGGAGGTGCAGCGGCCGG - Intronic
1035125813 7:156607345-156607367 GCCCCAGGTGCGGCATCCGCAGG + Intergenic
1035205135 7:157290047-157290069 GCCCCAGATGAGGCAGCGTCGGG - Intergenic
1036166342 8:6437648-6437670 GCACCAGGTGAGGCAGCGGGAGG - Intronic
1036917859 8:12821788-12821810 GCCCAGGGTGGGGGCGTGGCAGG + Intergenic
1037381242 8:18287520-18287542 GCCCAAGATTGGCCAGCAGCGGG - Intergenic
1037387411 8:18358233-18358255 GCCCAAGGTGGGGATGGGACAGG - Intergenic
1038949539 8:32399456-32399478 GGCCAAGGCGGGGCAGAGGGCGG + Intronic
1039819927 8:41126355-41126377 ACGCAAGGAGGGGCAGCGGCAGG - Intergenic
1041136844 8:54768094-54768116 GGACAAGATGGGGTAGCGGCAGG - Intergenic
1044053801 8:87542846-87542868 GACCAAGGTGGGGCTGAGGGTGG - Intronic
1045753638 8:105515710-105515732 GCCCAAAGTAGGGCAGAGCCTGG - Intronic
1048212240 8:132464873-132464895 GCCCAAGGTCTGGCATCTGCTGG + Intronic
1049421583 8:142518966-142518988 GCCCAAGGTCGGGCATCGGGAGG + Intronic
1049509842 8:143021947-143021969 GCCCCACTTGGGGCAGAGGCAGG - Exonic
1049544204 8:143221876-143221898 GCCCAGGGTTGGGGAGAGGCCGG - Intergenic
1049644528 8:143730120-143730142 GCCCAAGATGGCGCACCTGCTGG + Exonic
1052990410 9:34516135-34516157 GCCCATGGTGAGGGAGCAGCTGG + Intronic
1053691149 9:40588148-40588170 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1054097837 9:60917863-60917885 GCCCCAGATGGGACAGGGGCTGG - Intergenic
1054119239 9:61193493-61193515 GCCCCAGATGGGACAGGGGCTGG - Exonic
1054273655 9:63049343-63049365 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1054302409 9:63389119-63389141 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1054401179 9:64715613-64715635 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1054434790 9:65199939-65199961 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1054455275 9:65427159-65427181 ACCAGAGGTGGGGCAGCGGGGGG - Intergenic
1054495599 9:65821742-65821764 GCCCATGGTGGGGCCAGGGCAGG + Intergenic
1054588514 9:66989069-66989091 GCCCCAGATGGGACAGGGGCTGG + Intergenic
1054864223 9:69983491-69983513 GGCCAAGGTGAGGCACCAGCGGG + Intergenic
1055461433 9:76523815-76523837 GCACACGGTGGGGCAGCGGGGGG + Intergenic
1055986541 9:82060238-82060260 GCCCCAGATGGGACAGGGGCTGG + Intergenic
1056584801 9:87920894-87920916 GCCCCAGATGGGACAGGGGCTGG - Intergenic
1056731103 9:89167405-89167427 GCCCAAGGAAGGGGAGAGGCGGG + Intronic
1056999775 9:91497028-91497050 GCCCAGGTTGGTGCAGTGGCTGG + Intergenic
1057160625 9:92885959-92885981 GCCCCAGATGGGACAGGGGCTGG - Intergenic
1057490660 9:95517098-95517120 GCACAAGGTGGAGAAGCCGCGGG - Intergenic
1057755419 9:97831394-97831416 GGCCAAGGCCAGGCAGCGGCAGG - Intergenic
1057829304 9:98394741-98394763 GCCCAAGGAGGGGCTGGGGTGGG - Intronic
1058569440 9:106324826-106324848 CCCCATGGTGGGGCTGAGGCTGG + Intergenic
1058963581 9:110015670-110015692 GCCCAGGGTGGAGAAGAGGCTGG - Intronic
1059950887 9:119461449-119461471 GCCCGAGGGGAGGCAGTGGCAGG - Intergenic
1060549029 9:124476559-124476581 GCCCAGGGAGGGGGAGCTGCTGG + Intronic
1060890467 9:127184766-127184788 GCTCAGCGTGGGGCAGAGGCTGG + Intronic
1061233986 9:129331855-129331877 CTCCAGGCTGGGGCAGCGGCAGG + Intergenic
1061537898 9:131260848-131260870 GCCCAAGTACGGGCAGCCGCTGG - Exonic
1061566151 9:131441833-131441855 GCCACTGGTGGGGCAGCAGCTGG - Intronic
1061632758 9:131883527-131883549 GCACAAAGTGGGGAAGGGGCAGG + Intronic
1061940050 9:133878989-133879011 GAGCATGGTGGGGCAGGGGCAGG + Intronic
1062029347 9:134355116-134355138 GTTCAAGGTGGGGCTGGGGCTGG + Intronic
1062129728 9:134885891-134885913 GCCCAGGGTAGGGCCGCTGCTGG + Exonic
1062289910 9:135789822-135789844 GCCTGGGGTGGGGCAGGGGCTGG - Intronic
1062371267 9:136240090-136240112 GCACAGGGTGTGGCAGGGGCGGG + Intronic
1062579759 9:137223969-137223991 GCCCAAGGTGGGGACGCTGGGGG + Intergenic
1062637716 9:137500335-137500357 GCCCACGTTGGGGCAGGGCCGGG - Intronic
1203784970 EBV:122542-122564 GCCCACGGTGGGGCGGAGGTCGG + Intergenic
1203621820 Un_KI270749v1:134311-134333 GCCCATGGTGGGGCCAGGGCAGG - Intergenic
1186381772 X:9068206-9068228 GCACAAGAAGGGGCAGCAGCAGG + Intronic
1186511886 X:10135648-10135670 GCCCCAGGTGGCGCCGCGTCCGG + Intronic
1190641438 X:52484607-52484629 GGCCATGGTGGGGCAGGAGCAGG + Intergenic
1190646234 X:52528258-52528280 GGCCATGGTGGGGCAGGAGCAGG - Intergenic
1190906908 X:54736787-54736809 ATCCCAGATGGGGCAGCGGCCGG - Intergenic
1192588464 X:72339732-72339754 GGCCATGATGGGGCAGCAGCTGG - Intronic
1194173449 X:90617841-90617863 GCCCATGGTTGGGCAGGGGAGGG + Intergenic
1195168913 X:102247012-102247034 GCCCCAGGAGGGGGAGGGGCAGG + Intergenic
1195189944 X:102440074-102440096 GCCCCAGGAGGGGGAGGGGCAGG - Intronic
1196670597 X:118362922-118362944 ACCCTAGGTGGGGAAGAGGCAGG + Intronic
1197753244 X:129979904-129979926 GCCCAGGGTGGGGAAGTGGGGGG + Intergenic
1198330116 X:135614993-135615015 GCCCAATTTGGGACAGGGGCAGG + Intergenic
1198336811 X:135674007-135674029 GCCCAATTTGGGACAGGGGCAGG - Intergenic
1198362783 X:135912457-135912479 GCCCAATTTGGGACAGGGGCAGG + Intronic
1199836699 X:151599341-151599363 CTCCCAGATGGGGCAGCGGCCGG + Intronic
1200519671 Y:4195533-4195555 GCCCACGGTTGGGCAGGGGAGGG + Intergenic
1201469126 Y:14314724-14314746 GCCCACGGTGGGGAAGGGGGAGG - Intergenic
1202584559 Y:26409355-26409377 GGCCAAGATGGGGCCGGGGCTGG + Intergenic