ID: 1140126121

View in Genome Browser
Species Human (GRCh38)
Location 16:72120281-72120303
Sequence GGTCTGAGTGGACCAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140126112_1140126121 1 Left 1140126112 16:72120257-72120279 CCTGTGAAAGAAGCCCAGGCCTG 0: 1
1: 1
2: 2
3: 20
4: 219
Right 1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 244
1140126110_1140126121 12 Left 1140126110 16:72120246-72120268 CCTACGTGTGTCCTGTGAAAGAA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140126121 Original CRISPR GGTCTGAGTGGACCAGGAGC TGG Intronic
900097987 1:948090-948112 AGTCTGAGTCGGCCACGAGCCGG + Intronic
900240823 1:1616402-1616424 GGCCCGAGTGGACCTGGAGCCGG + Intronic
900245590 1:1634713-1634735 GCTCTCGGTGGACCAGGGGCTGG - Intronic
900256819 1:1701870-1701892 GCTCTCGGTGGACCAGGGGCTGG - Intronic
900405267 1:2490203-2490225 GGCCTGGGTGGGCCAGGTGCTGG - Intronic
901115747 1:6842349-6842371 GCACTGACTGGACTAGGAGCAGG - Intronic
901449970 1:9329970-9329992 GTTCAGAGTGGCCCAGGAGCAGG + Intronic
902096569 1:13950655-13950677 GGCCTGAGCAGACCAGGAGAGGG + Intergenic
902168490 1:14592032-14592054 TGAGTGAGAGGACCAGGAGCAGG - Intergenic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
904050312 1:27634636-27634658 GGTCTGATGGGTCCAGGAGAGGG - Intronic
905610603 1:39347210-39347232 GGTCAGACTGAACCAGCAGCTGG + Intronic
905901585 1:41584961-41584983 GCTGTGAGTGGACTCGGAGCAGG + Exonic
906126200 1:43428392-43428414 GGGCTGAGAGGACCAGGACTTGG - Exonic
907188705 1:52631874-52631896 GGTCTGAGCAGACTGGGAGCTGG - Intergenic
908757087 1:67479171-67479193 GGTCTGAGTGGTGGAGGAACAGG - Intergenic
910269230 1:85375386-85375408 AGTCAGTGTGGACAAGGAGCTGG - Intronic
915163914 1:153937851-153937873 GCTCTGGGTGGACCTGGAGAAGG + Exonic
915230526 1:154442455-154442477 GGTCTGAGTGGGACAGGTGGAGG + Intronic
915934200 1:160081362-160081384 GCTCTGAGTTGTCCAGGAGGAGG + Intergenic
917688667 1:177444899-177444921 GTTCAGAGAGAACCAGGAGCGGG + Intergenic
918084952 1:181237442-181237464 GGCATGGGTGGACCAGGAGCTGG + Intergenic
920274777 1:204796016-204796038 GATCTCAGTGGAGGAGGAGCAGG - Intergenic
922188946 1:223300124-223300146 GGTCAGAGCAGACCAGGGGCAGG + Intronic
923144465 1:231188191-231188213 GCTCTGTGTGGGACAGGAGCAGG + Intronic
1063034231 10:2269344-2269366 GGTGTGAGTGGACCAGAGGTGGG + Intergenic
1067479915 10:46587906-46587928 GGGCTGTGAGGACCAGGAGCCGG - Intronic
1067559010 10:47291583-47291605 GCTGTGAGTGGACCCAGAGCAGG - Intergenic
1067614822 10:47753891-47753913 GGGCTGTGAGGACCAGGAGCCGG + Intergenic
1068927891 10:62558916-62558938 GGTGTGAGTGCAGCAGGAGAGGG + Intronic
1069983859 10:72270789-72270811 GGCCTGAGGGGAGGAGGAGCGGG + Intergenic
1070756863 10:78998669-78998691 GGCCTGAGGGGCCCAGGAGGTGG + Intergenic
1070794797 10:79210294-79210316 GGCCTGGATGGACCAGGAACTGG + Intronic
1071630230 10:87213854-87213876 GGGCTGTGAGGACCAGGGGCTGG + Intergenic
1073187358 10:101624644-101624666 TGGCTGAGTGGTCCAGGAGAAGG - Intronic
1074704429 10:116118530-116118552 GGCCTTGGTGGACAAGGAGCAGG - Intronic
1075072410 10:119327711-119327733 GGACTGAGTGGCCCAGGGCCAGG - Intronic
1075773565 10:124962307-124962329 GGTCAGGGTGGACCTGGAGTCGG - Intronic
1076410430 10:130245182-130245204 GGGCTGGGTGCACCAGGAGAAGG - Intergenic
1077435120 11:2535240-2535262 GGTGAAAGTGGACCAGGGGCAGG + Intronic
1077816331 11:5689219-5689241 GGTCTGTCTGGATTAGGAGCAGG + Intronic
1077872142 11:6271146-6271168 GGCCTGGGTGGGCCGGGAGCCGG - Exonic
1078933289 11:15929701-15929723 GGCCTGAGTGGACCCGGGTCAGG - Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1081673013 11:44951924-44951946 GGTCACAGTGGGCCAGGAACCGG + Intergenic
1081808081 11:45900815-45900837 GGTGAAAGTGGAGCAGGAGCAGG + Intronic
1082802647 11:57426018-57426040 GATCTGTGTGGACCAGATGCTGG - Exonic
1084268963 11:68019108-68019130 GGTGTGTGGAGACCAGGAGCTGG + Intronic
1084883044 11:72185711-72185733 GGACTGGATGGACCTGGAGCAGG + Intergenic
1085440983 11:76562075-76562097 GGTCTGAATTCACCAGGAACTGG - Intergenic
1085623030 11:78051347-78051369 GACCAGAGTGGACCAGGAGCAGG - Intronic
1087310569 11:96537263-96537285 GGTATGAGTGGAACATGAGATGG - Intergenic
1089956133 11:122573214-122573236 GGTCTGAGTGGATTAGGTGGGGG - Intergenic
1091066143 11:132514989-132515011 GGGCTAAGTGGAGCAGGAGGAGG + Intronic
1092145682 12:6212938-6212960 GGGGGGAGTGGGCCAGGAGCGGG + Intronic
1095322920 12:40851623-40851645 GGTCAGAATGGACCTGGACCTGG - Intronic
1096263919 12:50109367-50109389 GGGTAGAGTGGACCAGGAGTGGG + Intronic
1100411190 12:94321677-94321699 AGTCTGTGGGGACCAGGGGCTGG - Intronic
1101801172 12:108023169-108023191 GGTCTGAGTGAACCTGCAGAAGG + Intergenic
1102698363 12:114817600-114817622 TGTCTGAGTGGGCCAAGAGGTGG + Intergenic
1103725367 12:122995111-122995133 GGGCAGAATGGACCAGGGGCAGG - Intronic
1103888869 12:124223472-124223494 GGACTGACTGTACCAGGTGCTGG + Intronic
1104289626 12:127455784-127455806 AGGCAGAGGGGACCAGGAGCGGG + Intergenic
1104895307 12:132161012-132161034 GGCCAGAGGGGGCCAGGAGCTGG - Intergenic
1106704067 13:32261792-32261814 GGTCTGAGTGCTCCAGGATCTGG - Exonic
1106762260 13:32878791-32878813 GATCTGAGTGGTACAGGGGCTGG + Intergenic
1108432190 13:50365469-50365491 GTTCTGAGGGGAGAAGGAGCCGG + Intronic
1109338859 13:61028678-61028700 TGTGTGAGTGCACCAGGAGGAGG - Intergenic
1110931497 13:81223987-81224009 GGTCTGCGAGAACCAGCAGCCGG - Intergenic
1113198656 13:107839223-107839245 GGTGTGACTGGAATAGGAGCAGG - Intronic
1114991625 14:28296182-28296204 AGTCTGTGGGGACCAGGAACTGG - Intergenic
1118637465 14:67760950-67760972 ACTCTGAATGGACCAGCAGCTGG + Intronic
1119211132 14:72832936-72832958 GGTCTGAGGAAACCATGAGCAGG + Intronic
1122488290 14:102096043-102096065 GGTCTGAGAGCACCAAGATCAGG - Intronic
1125751717 15:42033708-42033730 GGTCTGTGAGGAGCAGGAGAGGG + Intronic
1125890156 15:43259949-43259971 GCTCTGGGTGGCCCGGGAGCGGG + Intronic
1125921230 15:43527048-43527070 GGTGTGGGGGGACCAGGAGCTGG - Exonic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1127371364 15:58344920-58344942 GGCATGAGTGGGGCAGGAGCAGG + Intronic
1128061463 15:64738362-64738384 GGTCTGAGTGGAGGAGGAGCCGG - Intergenic
1128308217 15:66613861-66613883 GGTCTGAGTGGAGGAGGAGGAGG + Intronic
1128608479 15:69055787-69055809 GGCCTGAGTGGACAGGGACCTGG + Intronic
1128620584 15:69146114-69146136 GGACTGAGTGGGAGAGGAGCAGG + Intergenic
1129451849 15:75655432-75655454 GGACTGAGTGGGCTGGGAGCTGG + Intronic
1129694216 15:77731415-77731437 GGGCTGAGGGCACCAGGAGTGGG - Intronic
1129851529 15:78796564-78796586 AGTCTGTGTGGGCCAGGAGCGGG - Intronic
1130101025 15:80894151-80894173 GCTCTGGGTGGGCAAGGAGCTGG - Intronic
1133080454 16:3314950-3314972 GGTCTCAGTGTTCCAGGAGCTGG + Intronic
1134488522 16:14678251-14678273 GGTGTGAGGGGAAGAGGAGCTGG - Intronic
1136172463 16:28497129-28497151 TGTCTCAGAGAACCAGGAGCTGG + Exonic
1136690370 16:32024268-32024290 GGGCTGAGAGGACCAGGTACAGG + Intergenic
1136790959 16:32967832-32967854 GGGCTGAGAGGACCAGGTACAGG + Intergenic
1136878854 16:33886100-33886122 GGGCTGAGAGGACCAGGTACAGG - Intergenic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140869077 16:79090208-79090230 GGTCTGAGTGGGCCAGGGTCGGG + Intronic
1141657288 16:85423011-85423033 GGGATGTGTGGACCAGGGGCTGG - Intergenic
1141887348 16:86901574-86901596 GGTCTGTGTGTACCAGGGCCTGG + Intergenic
1142006002 16:87689872-87689894 GGTGTCGGTGGACGAGGAGCGGG + Exonic
1203093166 16_KI270728v1_random:1229289-1229311 GGGCTGAGAGGACCAGGTACAGG + Intergenic
1142997717 17:3770774-3770796 GCTCTGAGTCCACCAGGGGCTGG - Intronic
1143295142 17:5865534-5865556 GGTCTTCATGGACCAGGAGGGGG - Intronic
1143780549 17:9226570-9226592 GGACTGAGTGCCCCAGGAGAGGG - Intronic
1143784775 17:9248058-9248080 GGGCTGAGAGGATGAGGAGCAGG - Intergenic
1144498556 17:15765701-15765723 GGGTTGAGGGGACCAGGAGGTGG + Intergenic
1145161938 17:20580741-20580763 GGGTTGAGGGGACCAGGAGGTGG + Exonic
1145218898 17:21072748-21072770 GGGCTGAGTGGGACAGGAGCTGG - Intergenic
1146610662 17:34302318-34302340 GGTCTGTGTGATGCAGGAGCTGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147153227 17:38530403-38530425 GGGCTGAGAGGACCAGGTACAGG + Exonic
1147599959 17:41739384-41739406 GGGCTCAGTGGCCCAGGAGTTGG - Intergenic
1148205787 17:45779012-45779034 GGTCTGATGGGAACAGGAGATGG - Intergenic
1148258591 17:46158948-46158970 GTTCTGAGTGGACCTGGAAAGGG - Intronic
1148325234 17:46779472-46779494 GGTCGGAGTGGAGGATGAGCCGG - Intronic
1151507940 17:74541690-74541712 GCTCCAAGAGGACCAGGAGCAGG + Exonic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1153285270 18:3450432-3450454 GGTCTGGAGGGGCCAGGAGCGGG - Intronic
1154186692 18:12191128-12191150 GGTCTGAGTGCAGCTGCAGCTGG - Intergenic
1155926165 18:31657887-31657909 GATTTGAGTGCAGCAGGAGCAGG - Intronic
1156536662 18:37870997-37871019 GGTCAGAGTGGACAAGGACCTGG + Intergenic
1157761303 18:50267499-50267521 GGTCACAGTGGACCAGGGTCAGG + Intronic
1158515045 18:58123834-58123856 GGCCTGAGTGAGACAGGAGCTGG - Intronic
1159042863 18:63341940-63341962 GGCCAGAGTGGGCCAGGAGTTGG + Intronic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161573303 19:5041830-5041852 GGTGTGTGTGGAACAGCAGCAGG + Intronic
1162804759 19:13131548-13131570 GAGCTGAATGGGCCAGGAGCTGG - Intronic
1165103045 19:33450265-33450287 TGTCTGGGAGGACCAGGAGAAGG - Intronic
1165532909 19:36418742-36418764 GCTCTGCGTGAACCCGGAGCCGG + Intergenic
1166561237 19:43733638-43733660 GGTGGGAGTGGGCCATGAGCTGG + Exonic
1167281065 19:48568839-48568861 GGCCTGAGTGGGACTGGAGCTGG - Intronic
1167693515 19:51001359-51001381 GGTCTGAGGGGACAGGGAGCTGG + Intronic
1168310847 19:55459788-55459810 GTTCTGAGGGAACCAGGAGCTGG + Intronic
925070677 2:964958-964980 GGACTGAGGGGCCAAGGAGCAGG - Intronic
925646797 2:6044442-6044464 AGTCTGTGAGGACTAGGAGCTGG + Intergenic
928095528 2:28402551-28402573 GGTCTGATTGGACCAGCATAGGG + Intronic
935210826 2:100938392-100938414 TGTCTGGGTGGACCAGGAGAGGG + Intronic
937373755 2:121321119-121321141 TGTCTGAGTGGACAATGAGGTGG - Intergenic
940398373 2:153220180-153220202 GGTATGAGTGGGGCAGGAGAGGG + Intergenic
944191631 2:197010024-197010046 AGTGTGAGGGGAGCAGGAGCAGG + Intronic
944289920 2:197993590-197993612 GGCCTGAGGGGACAAGGAGAAGG + Intronic
946122816 2:217531173-217531195 GCTCTGAGAGGTCCAGGAGATGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946333718 2:219024197-219024219 AGTCTTTGTTGACCAGGAGCAGG + Exonic
946822802 2:223647563-223647585 AGTCTGAGTGGACCAAGGGGTGG - Intergenic
947982917 2:234425576-234425598 GGTCTGAAGGGACCACCAGCAGG - Intergenic
948888317 2:240894838-240894860 CTTCTGCGTGGACCAGGGGCTGG - Intronic
1170051302 20:12148574-12148596 GGTCTGAGGGAGACAGGAGCAGG + Intergenic
1171479702 20:25444741-25444763 GCTCTGAGGGAACCAGGGGCAGG - Intronic
1172639465 20:36432134-36432156 GGACTGAGTGGACCAGGTGGCGG - Exonic
1174082930 20:47983609-47983631 GGGGTGAGTGCCCCAGGAGCAGG + Intergenic
1174133025 20:48359374-48359396 GGGGTGAGTGCCCCAGGAGCAGG - Intergenic
1174508158 20:51030497-51030519 TGTCTGAGGGGACCTGGACCTGG - Intergenic
1176717292 21:10364176-10364198 GGTCTGAGTGGACCAGACTAGGG - Intergenic
1180011118 21:45052171-45052193 ATTGTGAGTGGAACAGGAGCCGG + Intergenic
1180096433 21:45557378-45557400 GCTCTGGGTGAACCAGGTGCTGG + Intergenic
1180220859 21:46356954-46356976 GCTCTGTGTGGAAAAGGAGCAGG - Exonic
1180298515 22:11017095-11017117 GGTCTGAGTGGACCAGACTAGGG - Intergenic
1180601050 22:17015818-17015840 GGTCTGAGTGGACCAGACTAGGG + Intergenic
1180825014 22:18855928-18855950 GGTCTCAGTGGCCCAGGACAAGG + Intronic
1181085317 22:20437018-20437040 GCTCGAAGTGGACCAGAAGCGGG - Intronic
1181187717 22:21118620-21118642 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1181211481 22:21291873-21291895 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181500764 22:23314385-23314407 GGTCTCAGTGGCCCAGGACAAGG - Intronic
1181651385 22:24261046-24261068 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181705993 22:24649693-24649715 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1182424330 22:30264158-30264180 TGTCTGAGTTGTCCAGCAGCTGG + Exonic
1183267553 22:36838606-36838628 TGTGTGACTGGAGCAGGAGCTGG + Intergenic
1183333636 22:37234563-37234585 GGTCTCAGTGGACCAGGTCAGGG - Intronic
1183346448 22:37310933-37310955 GGTGTCAGTGGCCCAGGAGGAGG + Intronic
1183542699 22:38438800-38438822 GGAGTGAGTGGACCAGGATGAGG + Intronic
1184035811 22:41917568-41917590 GGAGTGAGTGGAGCAGGAGAGGG + Intergenic
1184042455 22:41952199-41952221 GCTCTGAGTGGGCCAGGAGGGGG - Intergenic
1184108713 22:42383208-42383230 GGTCAGAGAGGCCCAGGAGGTGG + Exonic
1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG + Intronic
1184281695 22:43441034-43441056 GGTCTGGGTGGAGCTAGAGCTGG - Intronic
1185101900 22:48845058-48845080 TGGCAGAGTGGACCAGGAGATGG - Intronic
1203215467 22_KI270731v1_random:3558-3580 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1203275159 22_KI270734v1_random:81833-81855 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
949903494 3:8839046-8839068 AGTCGGAGTGGGCCAGGAGATGG + Intronic
950183539 3:10931462-10931484 GGTCTGTGGGGGTCAGGAGCAGG - Intronic
950344837 3:12284026-12284048 TATCTGAGTGTACCAGGAGTTGG - Intergenic
954111009 3:48433035-48433057 GGGCTGAGAGGACCAAGAACTGG - Exonic
954239106 3:49279604-49279626 AGTCTGGGTGGAGCAGGAACTGG - Intronic
954434714 3:50489936-50489958 GGACTGAGTGTCCCAAGAGCAGG + Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960998817 3:123358648-123358670 GGTCCGAGTGGACAAGGTCCAGG + Intronic
968039695 3:195578843-195578865 GGGCTGAGGGGAACAGGACCAGG - Intronic
968620831 4:1602820-1602842 GGTCTGAGGGCAGCAGGAGCCGG + Intergenic
968830068 4:2928712-2928734 GCTCTGAGAGGACAAGGGGCAGG - Exonic
969274900 4:6128432-6128454 GCTCAGAAGGGACCAGGAGCGGG + Intronic
969417731 4:7071946-7071968 GGTCTGCAGGCACCAGGAGCTGG + Intergenic
972305009 4:37822527-37822549 GGGCTGAGTGAAACAGGAGAGGG + Intergenic
976613547 4:87053583-87053605 GTTTTGAGTGGTGCAGGAGCAGG - Intronic
981271415 4:142850560-142850582 GGACTCATTGGAGCAGGAGCTGG - Intergenic
982014997 4:151144791-151144813 GAGCTGAGTGGACCAGGAAGTGG - Intronic
985610383 5:884696-884718 GGTCTGAGTGGCCTAGGGCCAGG + Intronic
985916444 5:2922305-2922327 GGTCTGAGTGCAGCCGGTGCAGG - Intergenic
986240032 5:5952461-5952483 AGTCAGAGTGGGCCAGGAGAGGG + Intergenic
986588703 5:9346292-9346314 GGTCTCAGTGGAAGGGGAGCTGG - Intronic
986785296 5:11108767-11108789 GGTCTGACCTGACCAGCAGCTGG + Intronic
987118076 5:14742242-14742264 GGTCTGCTGGGACCAGGAGCGGG - Intronic
987128996 5:14843114-14843136 GAGCTGAGTGGCCCAGGAGATGG - Intronic
987965739 5:24869799-24869821 GGTCTAAGTGAATTAGGAGCGGG + Intergenic
991267829 5:64743854-64743876 GGCATGAGTGGAGCAGGAGAGGG + Intronic
993018541 5:82563849-82563871 AGTCTGTGAGGACCAGGGGCTGG + Intergenic
998165809 5:139842898-139842920 CCTCTGAGTTGACCAGCAGCAGG + Exonic
1000042861 5:157498137-157498159 GGGAGGAGTGGCCCAGGAGCAGG - Intronic
1000225525 5:159257604-159257626 GGTCTGAGTGGACTAGCTGGGGG + Intergenic
1001081707 5:168672168-168672190 GTTCTGGGTGCACCTGGAGCAGG + Intronic
1002061941 5:176630351-176630373 GGCCGGGGTGGACCAGGGGCCGG + Exonic
1002397999 5:178972755-178972777 GGGGTGAGAGAACCAGGAGCAGG + Intergenic
1003398646 6:5774090-5774112 GGTCAGAGTGGACCCTGAGGGGG - Intergenic
1005700922 6:28399578-28399600 GGCCTGAGGGGCCCAGCAGCTGG + Intronic
1006044865 6:31286632-31286654 GAGGTGAGTGGTCCAGGAGCTGG - Intronic
1006376270 6:33673293-33673315 GGACTGAGTGGGCCGGGCGCAGG + Intronic
1006436094 6:34026885-34026907 GGTCTGGATGGAACAGGACCTGG + Intronic
1006474073 6:34244091-34244113 GGTAGGAGAGGGCCAGGAGCTGG - Intronic
1006626912 6:35404122-35404144 GGTAAGACTGGACCAGGAGCTGG - Intronic
1007777149 6:44230185-44230207 GGCCTGAGTGGGCCTGGACCAGG + Intronic
1008486868 6:52046028-52046050 AATCTGAGTGGACCAGGACAAGG + Exonic
1012949482 6:105503027-105503049 GACCTGATGGGACCAGGAGCAGG - Intergenic
1014137748 6:117907949-117907971 GGACGGAGGGGACCCGGAGCCGG - Intronic
1016847372 6:148581643-148581665 GGCATGAGTGGATCAGGAGAGGG - Intergenic
1017052150 6:150403395-150403417 GGGCTGAGTGGGGCAGGAGAAGG - Exonic
1017123085 6:151042135-151042157 GGTCTTAGATGACCACGAGCTGG - Intronic
1017500220 6:155017164-155017186 AGTCTGGCTGGTCCAGGAGCAGG + Intronic
1017857027 6:158358883-158358905 GGTGTGAGAAGACCAGCAGCTGG + Intronic
1018911532 6:168103174-168103196 GATCAGAGTGGACCAAGAGTGGG - Intergenic
1019438051 7:1031859-1031881 GGGCAGAGTGGTCCAGGTGCGGG + Intronic
1019515386 7:1437735-1437757 GGTCTGGGTGGGCCAGGCGGGGG - Intronic
1020276690 7:6628802-6628824 GGTCTGAGTGGTCCTGTGGCTGG + Intergenic
1020418185 7:7969373-7969395 GGTCTGAGAGGAACTGGAGGAGG - Exonic
1021576345 7:22109244-22109266 GGTCTGCCTGTCCCAGGAGCTGG - Intergenic
1021868380 7:24980239-24980261 GGCCTGAGAGGCCCAGGGGCGGG + Intronic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023844126 7:44111636-44111658 GGTCTGTGGGGGCCAGCAGCTGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1023907310 7:44531766-44531788 CGTGGGACTGGACCAGGAGCTGG - Exonic
1026149542 7:67776309-67776331 GCTGTGGGTTGACCAGGAGCAGG - Intergenic
1031016103 7:116578318-116578340 AGTCTGGGAAGACCAGGAGCAGG - Intergenic
1031977069 7:128100969-128100991 GGGCTGAGTGGACCATGGGCAGG + Intergenic
1034270289 7:149800357-149800379 GGGCTGCGTGGAACAGGCGCAGG + Intergenic
1034671830 7:152864966-152864988 AGTTTGAATGGACCAGGAACTGG + Intergenic
1035082500 7:156228627-156228649 CGTCAGAATGGATCAGGAGCTGG + Intergenic
1035281458 7:157781011-157781033 GGTGTGAGTGGACCAGGATGTGG - Intronic
1035828336 8:2668330-2668352 GGTCCCAGAGGACCGGGAGCAGG + Intergenic
1036208606 8:6824040-6824062 GGACTTAGAGGATCAGGAGCTGG - Intronic
1038945212 8:32351643-32351665 GGCCTGGGTGGACTAGGAGTGGG - Intronic
1039177247 8:34823753-34823775 GGCCTGAGGCCACCAGGAGCAGG + Intergenic
1041393778 8:57371927-57371949 GGTCTAAGTGAGACAGGAGCAGG - Intergenic
1044090679 8:87996420-87996442 GGTCAGTGTGGTCCAGCAGCAGG - Intergenic
1045010593 8:97955399-97955421 GGTCTGAGGGGTACAGGAGAGGG + Intronic
1045933954 8:107657604-107657626 GGCATGAGTGGAGCAGGAGAGGG + Intergenic
1049654552 8:143791911-143791933 GGTCTGGGGGGACAAGAAGCGGG + Exonic
1049799896 8:144512895-144512917 GGTCTGCATGGGCCATGAGCGGG - Exonic
1052981891 9:34456302-34456324 GGTCTGTGTGGCCCTGGAGTTGG - Intronic
1053008421 9:34619901-34619923 GGTCTGAAAGGACCAGGATTAGG - Intronic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG + Intergenic
1056762969 9:89427891-89427913 GGTCTGAGAGCTCCAGGAGGGGG + Intronic
1056986021 9:91364312-91364334 GCTCTTAGGGGGCCAGGAGCAGG + Intergenic
1057115066 9:92513190-92513212 GCTCTGAGTGGAACAACAGCAGG - Intronic
1057444470 9:95104077-95104099 GGTCTGCTTGGCCCACGAGCAGG - Intronic
1057585705 9:96327004-96327026 GGTCTGAGTGGCTCCGGGGCAGG - Intronic
1060213560 9:121724932-121724954 GGTCTGAGAGGGCCAGGGGCAGG + Intronic
1060421950 9:123475600-123475622 TGCCTGAGTGGTCCAGGTGCAGG + Intronic
1060506035 9:124199089-124199111 GGTCTGTGTGGAACAGAGGCTGG - Intergenic
1061221909 9:129257099-129257121 TGTCTGTGTGGTCCAGAAGCCGG - Intergenic
1061231095 9:129316234-129316256 GGGCAGAGTGGCCCATGAGCTGG + Intergenic
1061273549 9:129557400-129557422 GGACAGGGTGGTCCAGGAGCAGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062547625 9:137070742-137070764 GGCCAGAGTGGAGCAGGAGCTGG - Intergenic
1187528187 X:20072641-20072663 AGTCTGAGTGGACTAGGTGGGGG - Intronic
1190582386 X:51901818-51901840 GGTCTGAGGGAATCTGGAGCGGG - Exonic
1192179587 X:68908188-68908210 AGTCTGAGTGGACCAAGAGATGG + Intergenic
1194358917 X:92922714-92922736 GGTCTGTGTGAACCAGGTTCAGG + Intergenic
1199553353 X:149080205-149080227 GGACTGAGTGGACGGGGAACAGG - Intergenic
1200667131 Y:6038727-6038749 GGTCTGTGTGAACCAGGTTCAGG + Intergenic