ID: 1140131586

View in Genome Browser
Species Human (GRCh38)
Location 16:72166593-72166615
Sequence AGGGGGAAGCAGGACAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1652
Summary {0: 1, 1: 1, 2: 22, 3: 196, 4: 1432}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140131576_1140131586 0 Left 1140131576 16:72166570-72166592 CCCAAGAAAAACCAGCATGGAAG 0: 1
1: 0
2: 6
3: 28
4: 421
Right 1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG 0: 1
1: 1
2: 22
3: 196
4: 1432
1140131577_1140131586 -1 Left 1140131577 16:72166571-72166593 CCAAGAAAAACCAGCATGGAAGA 0: 1
1: 0
2: 3
3: 30
4: 293
Right 1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG 0: 1
1: 1
2: 22
3: 196
4: 1432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140131586 Original CRISPR AGGGGGAAGCAGGACAGGGA AGG Intronic
900122232 1:1053696-1053718 AGGTGGCAACAGGACAGGGTGGG - Intronic
900238260 1:1602594-1602616 AGGGGTGAGGAGGAGAGGGAGGG + Intergenic
900394090 1:2446093-2446115 ACAGGGAAGCAGGACGGGGGTGG - Intronic
900465400 1:2822786-2822808 AGGTGGTTGCAGGACAGGAAGGG + Intergenic
900579108 1:3399581-3399603 GGGGAGCAGCAGGGCAGGGATGG + Intronic
900595195 1:3477262-3477284 AGGGGGTGGCAGTACAGGGTGGG - Intronic
900621051 1:3588038-3588060 AGGAGGGGGCAGGACAGGGCAGG + Intronic
900621239 1:3588488-3588510 AGGAGGGGGCAGGACAGGGCAGG + Intronic
900699007 1:4032410-4032432 ACACGGAAGCAGGAAAGGGATGG - Intergenic
900703132 1:4060324-4060346 AGGGGGAGGCGGGAGAGGGGTGG + Intergenic
900786233 1:4652648-4652670 AGGAGCCAGCAGGGCAGGGAGGG - Intergenic
900932838 1:5747645-5747667 AGAGGGAGGGAGGAGAGGGAGGG + Intergenic
900943079 1:5813744-5813766 AGGAGGAAGGAGAACAGAGAAGG + Intergenic
900969291 1:5980585-5980607 AGGAGGAGGCGAGACAGGGAGGG + Intronic
900994023 1:6110580-6110602 AGGGGGAGGCAGCTCAGGGAGGG + Intronic
901035689 1:6334671-6334693 GTGGGGCTGCAGGACAGGGAAGG + Intronic
901155726 1:7136824-7136846 AGGGGTTAGCAGGACAAAGAAGG - Intronic
901159471 1:7163792-7163814 TGCGGGGAGCAGGCCAGGGAGGG + Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901744216 1:11361911-11361933 AGGGGGAGGGAAGAAAGGGAAGG + Intergenic
901750620 1:11405125-11405147 AGGGGGAAGAAAGGAAGGGAAGG - Intergenic
901852781 1:12026587-12026609 ATGAGGATGCAGGACAGAGAGGG - Intronic
901871902 1:12143189-12143211 AGGGGGCTACAGGACAGGGAAGG - Exonic
902146074 1:14400131-14400153 AGGGATACCCAGGACAGGGACGG + Intergenic
902279350 1:15362934-15362956 AAGTGGAAGCAGCACTGGGAAGG - Intronic
902388218 1:16088142-16088164 AGGGGGAGGTAGGGCAGGGGTGG + Intergenic
902402484 1:16165845-16165867 AGAGGGAAACAGGGCAGGAAGGG - Intergenic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902598492 1:17525176-17525198 ATGGGGAGGGAGGAGAGGGAGGG + Intergenic
902805758 1:18860392-18860414 TGGGGGAAGGAGGGAAGGGAGGG + Intronic
902995564 1:20222339-20222361 AGGGAGAAGCAGGGCTGGGGAGG + Intergenic
903002850 1:20278777-20278799 AAGGGGAAGCAAGAGAGAGATGG + Intergenic
903064988 1:20694552-20694574 AGAGGGGACAAGGACAGGGATGG + Intronic
903172821 1:21564226-21564248 CGGGGGCAGCCGGGCAGGGACGG + Intronic
903176222 1:21583044-21583066 ATGAGGAAGCAAGACAGGAAAGG + Intergenic
903328683 1:22585999-22586021 ATGAGGAAGCAGGCCAGGGATGG - Intronic
903485289 1:23685396-23685418 AAGAGGAAGCAGGCCAGGCAAGG + Intergenic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903624330 1:24720312-24720334 AGGTGGGACCAGGACAGGAAGGG + Intergenic
903769775 1:25756609-25756631 TGGGGGAAGAGGGACAGAGATGG + Intronic
904194015 1:28770976-28770998 AAGGGAAAGAAGGACAGGCAAGG - Intergenic
904301366 1:29556791-29556813 GGAGGGAGGCAGGGCAGGGAAGG + Intergenic
904472115 1:30742405-30742427 CGGGGGGAGGAGGACAGGGAGGG - Intronic
904480706 1:30791594-30791616 AGGAGGAAGGGAGACAGGGAAGG + Intergenic
904704685 1:32380945-32380967 GGGGGGCAGCAGGGCTGGGAGGG + Intronic
904919145 1:33993214-33993236 AGGGGAAGGCAGGAGAGGGCTGG + Intronic
904948157 1:34214434-34214456 AAGAGGAAGCAGGATAGGGTGGG + Intronic
904950349 1:34233254-34233276 AGTGGTGAGCAGGACAGGGGAGG + Intergenic
905011152 1:34747914-34747936 TGGGGGAAGCAGGTCTGGGAGGG - Intronic
905246057 1:36614665-36614687 AGTGGGCTCCAGGACAGGGAGGG + Intergenic
905405002 1:37726668-37726690 TGGGAGGGGCAGGACAGGGAGGG - Intronic
905540449 1:38756239-38756261 GTAGGGAAGTAGGACAGGGATGG - Intergenic
905912609 1:41664231-41664253 AACGGGAAGCAGGACAGTGGGGG - Intronic
906138992 1:43522110-43522132 AAGGGGAAGCCGAACAGAGAAGG - Intergenic
906189271 1:43885489-43885511 AGGGGGTAGCAGGGGAGGGTGGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906469060 1:46111946-46111968 AGGGGGATGGAGGACAGAGATGG - Intronic
906509175 1:46401105-46401127 AGGGGGAAGCAGGCCAGGGGAGG + Intronic
906668175 1:47636396-47636418 AGAGGGGCGCGGGACAGGGAGGG - Intergenic
906727746 1:48056045-48056067 AGGTGGAGGCAGAAGAGGGAGGG - Intergenic
906778174 1:48548595-48548617 GGGGAGGAGCAGGACAGGGAAGG - Intronic
907248027 1:53120465-53120487 CAGGGGACGCAGGGCAGGGAAGG - Intronic
907255144 1:53173439-53173461 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255151 1:53173458-53173480 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255158 1:53173477-53173499 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907255165 1:53173496-53173518 AGGGGAGAGGAGGAGAGGGAGGG - Intergenic
907275028 1:53312175-53312197 ATGGGGAAACAGGCCAGGGAGGG + Intronic
907297968 1:53467631-53467653 AAGGGGAGGTAGAACAGGGAGGG - Intergenic
907306089 1:53513875-53513897 AGGAGGAGGAAGGGCAGGGAAGG + Intronic
907425376 1:54375990-54376012 AGAGGGATACAGGGCAGGGAGGG + Intronic
907445779 1:54506857-54506879 TGGGGGAGACAGGACAGGGTTGG + Intergenic
907628845 1:56060031-56060053 AGGGGGTAGCAGGAACAGGATGG + Intergenic
907696069 1:56730401-56730423 GAGGGGAAGGAGGAGAGGGAGGG + Intronic
907797699 1:57733875-57733897 AAGAAGAAGCAGCACAGGGAAGG + Intronic
907834232 1:58093865-58093887 AGGGGCAAGCAGGCCAGGAGAGG - Intronic
907843816 1:58185235-58185257 AGAGGGAAGCAGGAGAAGGATGG + Intronic
907848052 1:58227695-58227717 AGGGAGAAGTAGGTCATGGAGGG + Intronic
908007314 1:59740077-59740099 AGCCTGAAGGAGGACAGGGAGGG - Intronic
908060903 1:60347799-60347821 AGGGGGAGGGAGGAAAGGAAAGG + Intergenic
908571869 1:65419900-65419922 GGGGAGAGGCAGGAGAGGGAAGG - Intergenic
909169975 1:72282744-72282766 AGGGGGAGGGAGGGGAGGGAGGG - Intergenic
909938411 1:81581928-81581950 AAGGGGAAACAGGACAGGCATGG + Intronic
910002127 1:82353856-82353878 AAGTGGAAGCAGGAGAGAGAGGG + Intergenic
910028509 1:82687913-82687935 AAGGGGAGGCAGGAGAGGCAGGG - Intergenic
910107048 1:83642848-83642870 AGGGGCAGGGAGGAGAGGGAGGG + Intergenic
910166080 1:84328879-84328901 TGACAGAAGCAGGACAGGGATGG + Intronic
910241640 1:85093050-85093072 AGGAGGAGACAGGACCGGGAAGG + Intronic
910523308 1:88148538-88148560 AGGAGGAAGGAAGAGAGGGAGGG + Intergenic
910576169 1:88766101-88766123 ATGTGGAATCAGGCCAGGGATGG - Intronic
911909622 1:103616418-103616440 AGGGAGAAACAGAACAGGGCAGG + Intergenic
912314465 1:108654421-108654443 AGGGGTGAACAGGAGAGGGAGGG + Intronic
912336886 1:108871522-108871544 AGAGTGAAACAGGATAGGGAAGG - Intronic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
912957489 1:114165693-114165715 TGAGGGAAGGAGGACAAGGAAGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
913692689 1:121294224-121294246 AGGAGAAAGAAGGAGAGGGATGG - Intronic
914144867 1:144985866-144985888 AGGAGAAAGAAGGAGAGGGATGG + Intronic
915095643 1:153460316-153460338 AGGGAGGAAGAGGACAGGGAGGG + Intronic
915164576 1:153941480-153941502 ATGTGGAGGGAGGACAGGGATGG - Intronic
915342560 1:155184490-155184512 TGGGGGGCACAGGACAGGGATGG - Exonic
915349490 1:155215465-155215487 TGGGGAAAGCTGGACAGGAAGGG + Intergenic
915352686 1:155236147-155236169 TGGGGAAAGCTGGACAGGAAGGG + Intronic
915461493 1:156073161-156073183 TGGGGGAAGCAGGCATGGGAGGG + Exonic
915517843 1:156423504-156423526 AGGAGGAAGCAAAATAGGGAGGG - Intronic
915527562 1:156485335-156485357 TGAGGGAAGGAGGAGAGGGAAGG + Intronic
915543643 1:156583706-156583728 AGAAGGAAACAGGAAAGGGAGGG - Intronic
915593884 1:156885593-156885615 AGGAGGAGGAAGGATAGGGAGGG - Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915971454 1:160358122-160358144 AGGGGGAGGGAGGGCAGGAAAGG - Intronic
915985222 1:160457858-160457880 AGGAGGAAACAGGAAAGGGAAGG + Intergenic
916213594 1:162377674-162377696 AGGGGGCAGGAGGAAGGGGACGG - Intronic
916275394 1:162988370-162988392 AGGGTGAAGAAGGAAAAGGAGGG + Intergenic
916435325 1:164772636-164772658 AGGTGTAAGGAGGACAGGGCAGG - Intronic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
917121513 1:171648425-171648447 AGGGGAAAGTGAGACAGGGAAGG - Intronic
917190045 1:172406192-172406214 AGGGGAAGGCAGGTCAGGGAAGG + Intronic
917389777 1:174522537-174522559 AGGGGGAAGGAGGTGAGGGGAGG + Intronic
917511405 1:175672239-175672261 CAGGGGAGGCAGGGCAGGGATGG - Intronic
917739748 1:177950987-177951009 GAGGGGAGGGAGGACAGGGAGGG + Intronic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918069470 1:181124455-181124477 AAGGGGAAGCAGGGAAGGGGAGG - Intergenic
918085864 1:181244754-181244776 AAGGGGAAAGAGGAGAGGGAGGG + Intergenic
918495029 1:185125905-185125927 AGGGTGGGGCAGGACAGGGCAGG + Intronic
918586152 1:186191154-186191176 AGTGGGAGTCATGACAGGGAAGG - Intergenic
918610500 1:186484812-186484834 AGGAGGAAGAAGGAAAGGCAAGG + Intergenic
918918740 1:190676825-190676847 AAGGGGAAGCAAGACAAGAAAGG - Intergenic
919061626 1:192641397-192641419 GGGAGGAAGGAGGAGAGGGAAGG + Intronic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920103308 1:203532059-203532081 GGGAGCAAGCAGGGCAGGGATGG - Intergenic
920182890 1:204143439-204143461 GGAGGGAAGCAGAGCAGGGAGGG - Intronic
920428300 1:205896681-205896703 AGGGGGAGGGAGGGGAGGGAAGG - Intergenic
920480009 1:206312585-206312607 AGGAGAAAGAAGGAGAGGGATGG - Intronic
920500106 1:206480322-206480344 AGGGGGAGGCAGGCCAGAGGGGG + Intronic
920863724 1:209733757-209733779 AGGGGGAAACAAGAAAGGAATGG + Intronic
921049559 1:211501307-211501329 AGGGTGGAGCTGGAGAGGGAAGG + Intergenic
921264378 1:213410370-213410392 AGGTGGAGGCAGGTCAGTGATGG + Intergenic
922145554 1:222940287-222940309 AAGGGGAAGCTGGCCAGAGAAGG + Intronic
922654081 1:227365630-227365652 AGGAGGAAGGAAGAAAGGGAAGG + Intergenic
922931366 1:229392394-229392416 TAAGGGAAGCAGGAAAGGGAAGG - Intergenic
923051599 1:230394439-230394461 GGGGAGGAGCAGCACAGGGAGGG - Intronic
923189977 1:231611060-231611082 AGTGGGAAGCAGGAGAGAGGTGG - Intronic
923306880 1:232696681-232696703 AGGGGGAGTCAGGAAAGGAAGGG + Intergenic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923498421 1:234544529-234544551 AGGAGGGTGCAGGAGAGGGAGGG + Intergenic
923651280 1:235876317-235876339 TGTGGGAAGCAGGAGAGGGAGGG - Intronic
923700852 1:236298958-236298980 AGAAGGCAGCCGGACAGGGAGGG + Intergenic
923776101 1:236979887-236979909 AGAGGAAAGCAGGAGATGGAAGG + Intergenic
924274072 1:242367428-242367450 AGAGGGCAGAAGGACAGGGTAGG - Intronic
924448278 1:244154954-244154976 AGGGGGAGACAGGACAAGAAAGG - Intergenic
924458201 1:244234907-244234929 GGGAGGAGGCAGGAGAGGGAAGG + Intergenic
924539901 1:244970768-244970790 AGGGGGAAGGAGGACGGGGCGGG - Exonic
924607184 1:245544855-245544877 AGTGGGAAGGAGGGAAGGGATGG - Intronic
924683043 1:246257869-246257891 AGGCAGAAGCAGGAGAGGGAAGG - Intronic
1062812485 10:477326-477348 AGGGGGAGGGAGGGGAGGGAGGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062915819 10:1240659-1240681 ATGGGGAACCAGCACAGGGGAGG - Intronic
1063009026 10:2004352-2004374 AGGGAGAAGCTGAACAGTGATGG + Intergenic
1063085968 10:2817974-2817996 CCGGGGCAGCAGGTCAGGGAAGG - Intergenic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063576308 10:7265170-7265192 AGAGGGAGGCAGGGGAGGGAGGG - Intronic
1063907074 10:10792064-10792086 GGGAGGAAGGAGGAAAGGGAGGG + Intergenic
1064076039 10:12269583-12269605 CGGGGGAAGGAGGGCGGGGAAGG - Intergenic
1064123395 10:12638565-12638587 AGGGGGAGGCTGGCCAGGGTCGG - Intronic
1064209354 10:13349596-13349618 AGGGGAATGCAGCCCAGGGAAGG + Intergenic
1064246536 10:13672149-13672171 AGGGAGAAGCAGGCGAGTGACGG - Intronic
1064478298 10:15715337-15715359 AGGGGAATGGAGGAGAGGGAGGG + Intronic
1065853870 10:29814139-29814161 AGAGGGAAGGAGGAAAGAGAAGG - Intergenic
1066344876 10:34574984-34575006 AGGGGGGAGCAGGGGAGGGGAGG - Intronic
1067277905 10:44850919-44850941 ATGGTGCAGCAGGACAGAGAGGG - Intergenic
1067364004 10:45608124-45608146 AGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1067557897 10:47285076-47285098 AAGGGGAGGGAGGGCAGGGAGGG + Intergenic
1067843642 10:49701599-49701621 AGGAGGAAGCAGCACGAGGAAGG - Intronic
1067935915 10:50611969-50611991 AGGAGAAATCAGGACTGGGAGGG - Intronic
1068380231 10:56244324-56244346 AGTGGGAACCAGTGCAGGGATGG + Intergenic
1068839288 10:61592129-61592151 AGAAGGAAGCAGGAAAGGGCAGG - Intergenic
1069531086 10:69220160-69220182 AGGGGGAAGCAGGGTATTGATGG - Intergenic
1069580049 10:69559655-69559677 TGGGGGGAGAAGGCCAGGGATGG + Intergenic
1069943607 10:71971542-71971564 AGGGGGAAGCGGGAAAGGGTAGG - Intronic
1070327686 10:75399191-75399213 AGGGGGTGGCCGGCCAGGGAGGG + Exonic
1070337850 10:75470862-75470884 ATGGGAAAGCAGGGCAGGGCTGG - Intronic
1070373468 10:75807235-75807257 AGAGGGATGCAGCACAGGGAGGG + Intronic
1070650422 10:78231466-78231488 TGGGGAAAACAAGACAGGGAAGG - Intergenic
1070665039 10:78336722-78336744 AGGCTGGAGCAGGGCAGGGAAGG + Intergenic
1070739462 10:78893124-78893146 AGGTGGACTCAGGAAAGGGATGG + Intergenic
1070774457 10:79101677-79101699 TGGGTGAACCAGGGCAGGGAGGG + Intronic
1070915091 10:80148371-80148393 AAGCGGAAGCAAGAGAGGGAAGG + Intergenic
1071480661 10:86062453-86062475 TGGGGAAAACAGGACAGGGAAGG - Intronic
1071487000 10:86108913-86108935 AGAGGGAAGCCGGACAGGGTGGG - Intronic
1071528563 10:86372510-86372532 AGGCGGAAGCAAGTAAGGGAAGG + Intergenic
1071718445 10:88120006-88120028 AGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1071718484 10:88120112-88120134 AGGGGGAAGCAGGAACGAGGGGG + Intergenic
1071718499 10:88120165-88120187 AGGGGGAAGCAGGAACGAGGGGG + Intergenic
1071807692 10:89142566-89142588 AGGGGAAAGTAGGGGAGGGAAGG + Intergenic
1072069133 10:91899728-91899750 AGGAGGAAGGAGGATAGGGTAGG - Intergenic
1072442809 10:95471778-95471800 AGTGGAAGGCAGGAGAGGGAAGG + Intronic
1072661086 10:97363953-97363975 AGGGGGCAGAAGGAAAGGGTAGG - Intronic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1072944181 10:99795023-99795045 AGGAGGCAGTAGGACAGGAAAGG + Intronic
1073112648 10:101071870-101071892 AGGCGGAGGCAGGATAGAGATGG + Intergenic
1073220513 10:101868567-101868589 AGGAGGAAGGAGGACAGGGAGGG - Intronic
1073339698 10:102735466-102735488 AGGGGGAAGAGCGACATGGAGGG - Intronic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073377656 10:103050674-103050696 TGTGGGAAGCAGGATAGGGTAGG + Intronic
1073533569 10:104254830-104254852 AGGAGGAAGCGGGGGAGGGAAGG + Exonic
1073556317 10:104455771-104455793 ATGGTGAAGTAAGACAGGGAAGG + Intergenic
1073582199 10:104678888-104678910 GAGGGAAAGCAGGACAGGGAAGG + Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074242656 10:111654525-111654547 AGGGGGAGGAAGGGAAGGGAAGG - Intergenic
1074242672 10:111654564-111654586 AGGGGGAGGAAGGGAAGGGAAGG - Intergenic
1074359869 10:112816994-112817016 CGAGGGAAGCAGGACAGAGAAGG + Exonic
1074426352 10:113354803-113354825 AGGGGAAAGCAGAGAAGGGAAGG + Intergenic
1074712079 10:116185698-116185720 GGTGGGGAGCAGGACAGGGAGGG - Intronic
1074878709 10:117634629-117634651 AGTGGGAAGTAGGATAGGGAAGG + Intergenic
1074992123 10:118718321-118718343 TGTGGGGGGCAGGACAGGGAAGG + Intronic
1075086097 10:119415386-119415408 AAGGGGAAGCAGGTCGGGCAGGG + Intronic
1075161653 10:120029620-120029642 AGGGAGGAGAGGGACAGGGAGGG + Intergenic
1075278689 10:121119691-121119713 AGAGGGAAGAAGGGCAGGTAGGG - Intergenic
1075387180 10:122063356-122063378 AGTCAGAAGCAGGACAAGGAGGG - Intronic
1075619739 10:123917024-123917046 AGGGGAAGCCAGGACAGGAAGGG + Intronic
1075630187 10:123995867-123995889 AGGGGGATGTGGGACAGGGAGGG + Intergenic
1075649651 10:124119256-124119278 AAGGGGAGGCAGGCCAGGGGAGG + Intergenic
1075684293 10:124353253-124353275 AGAGGAAAGGAGGACAGGAAGGG - Intergenic
1075689239 10:124384664-124384686 AGTCGGCAGCATGACAGGGACGG + Intergenic
1075808273 10:125205639-125205661 GTGGGGAGGCTGGACAGGGAAGG + Intergenic
1076220679 10:128730808-128730830 AGGGTGAGCCAGGACACGGAGGG + Intergenic
1076541381 10:131217250-131217272 AGAGAGAAGCAGGATAGGGGAGG - Intronic
1076566964 10:131405373-131405395 ACGGAGAACCAGGACAGGTAAGG + Intergenic
1076618236 10:131770881-131770903 GGGGAGATGCAGGACAGGGAGGG + Intergenic
1076690977 10:132223769-132223791 AGGCCCAGGCAGGACAGGGAGGG - Intronic
1076840876 10:133044593-133044615 TGGGGGCAGCAGGGGAGGGACGG + Intergenic
1076880948 10:133238940-133238962 AGGGGGTTGCGGGACAGGGATGG - Intronic
1077023633 11:430476-430498 AGGGGGCAGCAGGGGAGGGATGG + Intronic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077131230 11:973763-973785 TGGGGGCAGGAGGAGAGGGAGGG - Intronic
1077174058 11:1180798-1180820 AGGGGGAAGCTGGGCCGAGATGG + Intronic
1077280470 11:1742733-1742755 ATGGGAGAGCAGGGCAGGGAGGG + Intronic
1077443276 11:2578547-2578569 AGAGGGGAGCAGGCCTGGGAGGG + Intronic
1077782590 11:5347788-5347810 AGGAGGGAGCAGAAGAGGGAGGG + Intronic
1077809965 11:5627075-5627097 AGAGTGAAGAAGGACAGTGATGG + Intronic
1077875453 11:6301272-6301294 AGAGGGCAGGAGGACAGGGCTGG - Intergenic
1078095468 11:8293736-8293758 AGGGGGAAAGAGGTCAAGGATGG - Intergenic
1078127324 11:8580487-8580509 AGGGGGAAGGGGGAGGGGGATGG + Intronic
1078195592 11:9134339-9134361 AGAGGGAGGAAGGACTGGGAAGG - Intronic
1078350831 11:10591782-10591804 AGAGGAAAGGAGGACAGGGAAGG - Intronic
1078481985 11:11685209-11685231 AGAGGGAGGGAGGACAGAGAAGG + Intergenic
1078542397 11:12222537-12222559 AGGGGGAAGTAGGGAAGGGTGGG + Intronic
1078566863 11:12422669-12422691 GGGGGAAAGCAGGAAAGAGAAGG - Intronic
1078610217 11:12813243-12813265 AGGTGGAAGGATGCCAGGGAAGG + Intronic
1079145477 11:17847349-17847371 GGGGGGAAGGGGGACAGGGAGGG + Intronic
1079253465 11:18805657-18805679 TGGGGAAAGGAGGACAGGGAAGG + Intergenic
1079274396 11:19020801-19020823 TGGGGAAAAGAGGACAGGGAAGG + Intergenic
1079293232 11:19207722-19207744 AGCGTGAACCAGGACAGTGAGGG + Intronic
1079375552 11:19888661-19888683 AGAAGAAAGCAGGGCAGGGAAGG - Intronic
1079710674 11:23679717-23679739 AGGGGAAAGCTGGAGAGGAAGGG - Intergenic
1080459509 11:32440793-32440815 AGGGTGCAGCAGGGCAGGAAGGG + Intergenic
1080637166 11:34134293-34134315 TGGGGGAAGCAGGACAGTGCAGG - Intronic
1080760610 11:35245483-35245505 CGAGGGGAGCAGGACAGGGAAGG - Intergenic
1081391922 11:42539591-42539613 GTGGGGAAGTGGGACAGGGAAGG + Intergenic
1081631027 11:44690075-44690097 AGGGAGGAGGAGGAAAGGGAGGG + Intergenic
1081869337 11:46376239-46376261 AGGGGGAACCAGCACAGAGGAGG - Intronic
1082132362 11:48506207-48506229 AGGGGGAAGTGGAAGAGGGAAGG - Intergenic
1082132374 11:48506238-48506260 AGGGGGAAGGGGGAGAGGGAAGG - Intergenic
1082143679 11:48641024-48641046 AGAGGGAAGAAGGAAAGGAAAGG - Intergenic
1082244434 11:49905195-49905217 AGGGGGAAGGGGGAAGGGGAAGG + Intergenic
1082565825 11:54676827-54676849 AGGGGGAAGTGGAAGAGGGAAGG - Intergenic
1082565837 11:54676858-54676880 AGGGGGAAGGGGGAGAGGGAAGG - Intergenic
1082782670 11:57299842-57299864 AGAGGGAAGGAGGAGAGGAAGGG + Exonic
1082833887 11:57638569-57638591 AGGGGGAGCGAGGCCAGGGAGGG + Intergenic
1082892404 11:58154101-58154123 AGGAGGAAGGAGGAGGGGGAAGG + Intronic
1083179360 11:60974309-60974331 AGGGGGAAGAAGGAGAGGGGAGG - Intronic
1083208823 11:61169963-61169985 GCAGGGAAGCAGGACTGGGAAGG + Intergenic
1083211953 11:61193782-61193804 AGGCGGCAGCAGGACATGGGAGG + Intergenic
1083353455 11:62047609-62047631 GCAGGGAAGGAGGACAGGGAAGG - Intergenic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083478421 11:62928393-62928415 GGGGGCAAGTAGGACAGGGAAGG - Intergenic
1083487528 11:62993032-62993054 AGGGAGAACAAGGGCAGGGATGG + Exonic
1083799273 11:65037035-65037057 AGTGGGAAGAAGGAATGGGAGGG + Intronic
1083860818 11:65419072-65419094 TGGGGGAAGCAAGGCTGGGAGGG + Intergenic
1083876173 11:65525368-65525390 AAGGGGTAGCAGGCCGGGGAGGG + Intronic
1084165691 11:67373786-67373808 AGGGGGGAGGAGGGAAGGGAGGG + Intronic
1084194779 11:67518248-67518270 GGGAGGAAGCAGGACTGGGCAGG + Intergenic
1084435589 11:69137485-69137507 AGGAGGAAGCAGGGCAGAGTTGG - Intergenic
1084528527 11:69712747-69712769 TGGGGGCAGCTGGACAGGGAGGG - Intergenic
1084563308 11:69916014-69916036 AGGGAGGAGCAGGGCAGGGCCGG + Intergenic
1084569913 11:69953131-69953153 ATGGGGAAGGGGGAGAGGGACGG + Intergenic
1084642003 11:70431767-70431789 GGGGGTCAGCAGCACAGGGAGGG - Intronic
1084671797 11:70611423-70611445 ATGGGGAAGCAGGGCAGGTGGGG - Intronic
1084884288 11:72193368-72193390 AAGGGGAGGAAGGAAAGGGAGGG + Intronic
1084934680 11:72580539-72580561 AAGGGGAAGAAGGACGGGGTGGG + Intronic
1085025294 11:73232949-73232971 AGGGGTAAGGAGGAGAGGGAGGG + Intronic
1085272634 11:75279325-75279347 AGGGGGATGCAAGCCAGTGAAGG + Intronic
1085276554 11:75303790-75303812 AGGGGCCAGCAGGAGAGGGAGGG - Intronic
1085339087 11:75719683-75719705 GGGGAGAAGGAGGACAGGCAGGG + Intronic
1085402564 11:76243466-76243488 AGGGGGAAAGGGGAAAGGGATGG + Intergenic
1085498039 11:76990435-76990457 TGGGGGAAGCAGGAGAGGTTTGG + Intronic
1085511110 11:77088602-77088624 AGTGGGAAACAGGTCTGGGAAGG - Intronic
1085624573 11:78062114-78062136 AGGAGGAGGGAGCACAGGGAGGG - Intronic
1086518769 11:87646109-87646131 AGGGGGAAGGGGGAAAGGGAAGG - Intergenic
1087152652 11:94872550-94872572 AGGTGTAAGCTGGAGAGGGAAGG + Exonic
1087416231 11:97859379-97859401 AGGAAGAAGCAGGCCATGGAAGG + Intergenic
1087906618 11:103704814-103704836 AGGCTGAAACAGGCCAGGGAAGG - Intergenic
1088595477 11:111437424-111437446 AGGGGGATGCTGGAAAGGGATGG + Intronic
1088779510 11:113120836-113120858 AGAGGGAAGGAGGGCAGCGAGGG + Intronic
1088843385 11:113644952-113644974 AGGTGGAAGGAGGCCTGGGATGG + Intergenic
1089038879 11:115426689-115426711 AGGGGGAAGCAGGGGAGGGTGGG - Intronic
1089122618 11:116147994-116148016 TGGGGGAAGCCAGAAAGGGATGG - Intergenic
1089201054 11:116724964-116724986 AGGGGGAAGGAGGACAGGGAGGG - Intergenic
1089862514 11:121602604-121602626 AGGAGGAAGGAGAAGAGGGAGGG + Intronic
1090364210 11:126192656-126192678 AGGTGGCAGGAGGACAGGGAGGG - Intergenic
1090833845 11:130439398-130439420 AGGGAGAAAAAGGAGAGGGAGGG + Intergenic
1090939292 11:131373421-131373443 GGGGAGGAGCAGGTCAGGGAGGG - Intronic
1091634517 12:2186994-2187016 AGGGGGCAGCAGGACAGGAAAGG - Intronic
1091634523 12:2187014-2187036 TGGGGGCAGCAGGACAGGCAAGG - Intronic
1091692674 12:2607601-2607623 AGTGGAAAGTAGGAAAGGGATGG + Intronic
1091913658 12:4251816-4251838 AAAGGGAAGGAAGACAGGGAGGG + Intergenic
1092001816 12:5038992-5039014 AGATGGAAGCAGGAGGGGGAGGG - Intergenic
1092143167 12:6198070-6198092 GGGAGGAAGGAGGACAAGGAAGG - Intergenic
1092367524 12:7889521-7889543 AGGGGGAACCAGGTCAGGCACGG - Intronic
1092549878 12:9486893-9486915 GGAGAGAAGCAGGACAGGGGAGG + Intergenic
1092793649 12:12090241-12090263 AGGGGAAAGAAGGAAAGGAAGGG + Intronic
1092864338 12:12746778-12746800 AGGGGGAAGAAGAAGAGAGAAGG - Intronic
1092950386 12:13498256-13498278 GGGGGGAAGCAGAACTGAGAGGG + Intergenic
1093235433 12:16604340-16604362 AGGGGGGTGAAGGATAGGGAAGG - Intronic
1093267456 12:17020343-17020365 AGGGGGAAGGAAGGAAGGGAGGG - Intergenic
1093860236 12:24156317-24156339 TGGGGGCGGCAGGACAGGGAAGG - Intergenic
1094021412 12:25918039-25918061 AGGGGGAAGGAGGGCAGAGAGGG + Intergenic
1094039831 12:26111059-26111081 GGGGGAAAACAGGACAAGGAAGG + Intergenic
1094589786 12:31809421-31809443 GGAGGGAAGCAGGCCAGGGGAGG - Intergenic
1094636701 12:32233508-32233530 AGGGGGAAGAACGGGAGGGAGGG - Intronic
1095049868 12:37545877-37545899 AGGGGGCGGCAGGGGAGGGAGGG - Intergenic
1095169822 12:39020527-39020549 AGAGGGAAGGAGGGAAGGGAGGG + Intergenic
1095312466 12:40716324-40716346 AAGGGGAAGGAGGAAAGGAAGGG - Intronic
1095345189 12:41141816-41141838 TTGGGGATGCAGGAGAGGGAAGG + Intergenic
1095509259 12:42932022-42932044 AGGGGGAAGGAAGAAAGGAAGGG + Intergenic
1095969993 12:47894908-47894930 TGAGGGCGGCAGGACAGGGAAGG + Intronic
1095994907 12:48073005-48073027 GGAGGGAAGGGGGACAGGGAAGG + Intronic
1096075320 12:48800364-48800386 AGGAGGATGCAGGAGAGGCAGGG + Intergenic
1096103345 12:48982288-48982310 ATGAGGAGGCAGGACAGGAAGGG - Intergenic
1096214715 12:49792715-49792737 AGCGGGTAGCAGTGCAGGGAAGG + Exonic
1096638538 12:52976349-52976371 CGTGGGATGCAGGACATGGAAGG - Intergenic
1096786027 12:54017890-54017912 AGGGGGCTGCCAGACAGGGAGGG - Intronic
1096842946 12:54390452-54390474 CGGGGGCACCAGGAGAGGGAGGG - Intronic
1097057403 12:56258211-56258233 AGGAGGAAGCGGGAAAGGGCAGG + Intronic
1097166605 12:57089445-57089467 GTGGGGAAGCAGGACGGGGGTGG + Intronic
1097184874 12:57191154-57191176 AGGAGCAAGCTGGACAGGGTGGG - Intronic
1097243304 12:57591143-57591165 AGGGCGAGGCAGGACGGGGCGGG - Intergenic
1098028391 12:66230079-66230101 AGGGAGCATCAGGGCAGGGAGGG + Intronic
1098172045 12:67757043-67757065 AGGGTGACCCAGGGCAGGGAGGG - Intergenic
1098521274 12:71437524-71437546 ATGAGGAAGCAGGAGAGAGAGGG + Intronic
1099134891 12:78885255-78885277 AGGGGGAAGGAGGGAAGGGAAGG + Intronic
1099385309 12:82006249-82006271 GGGGGGAAGGAGGAAGGGGAGGG + Intergenic
1099831373 12:87847372-87847394 AGAGGGAAGCAAGACAGAGAGGG + Intergenic
1100262875 12:92949490-92949512 AGGAGGAAGGAAGAGAGGGAGGG + Intergenic
1100324727 12:93530234-93530256 AGAGGAAAGGAGGAAAGGGAAGG - Intergenic
1100346291 12:93734817-93734839 AGGGGGAAGACGGACAAGGAGGG - Intronic
1100912802 12:99384606-99384628 AGGGGAAGGCAGGGCAGGGCAGG - Intronic
1101529085 12:105558027-105558049 TGAGGAAAGCAGGACAGGAAAGG - Intergenic
1101788598 12:107908527-107908549 TGGGAGAAGCAAGGCAGGGAAGG + Intergenic
1101803385 12:108042333-108042355 AGGGATAAGGAGGACAGTGAAGG + Intergenic
1101856528 12:108448151-108448173 AGTGGGAGGCAGGAGAGGAAGGG - Intergenic
1101858404 12:108463049-108463071 AGGGGAAAGGAGGAGAGAGAGGG + Intergenic
1101922938 12:108947667-108947689 TGGGGCATGCTGGACAGGGAAGG + Intronic
1102022406 12:109693005-109693027 TGGGGAAAACAGGACAGGGAAGG - Intergenic
1102073942 12:110045024-110045046 AGGGGGAAGAAGGAAGGAGAAGG + Intronic
1102194325 12:111013676-111013698 ATGGGGAAGTGAGACAGGGAAGG - Intergenic
1102313657 12:111867754-111867776 AGGAGGAAGAAGGAGAGGGAAGG - Intronic
1102331214 12:112032591-112032613 AGGGGCAAGAAGGACAGTGGTGG - Intronic
1102500948 12:113352222-113352244 AGGGGTAAGGAGGGGAGGGAAGG - Intronic
1102507684 12:113394051-113394073 TGGGGGAAACAGGAGAGAGATGG + Intronic
1102599407 12:114017822-114017844 GAGGGGAAGCAGGATAGGAAAGG - Intergenic
1102682281 12:114698853-114698875 AGGGGGAAGGGGGACGGTGATGG - Intergenic
1102894067 12:116584542-116584564 AGGGGGAAGCAGGAGCAAGAAGG - Intergenic
1103204783 12:119120122-119120144 AGGAGGAAGGAAGAAAGGGAGGG - Intronic
1103523118 12:121549389-121549411 AGGTGGCAGGGGGACAGGGAAGG + Intronic
1103748546 12:123143109-123143131 AGGGGGGAGGGGGATAGGGATGG - Intronic
1103934082 12:124466141-124466163 GGGGGGCAGCAGGCCAGGGCGGG + Intronic
1103946919 12:124532027-124532049 AGGGTGCAGCAGCAGAGGGAGGG - Intronic
1103947125 12:124532856-124532878 TGGGGGAAGGAGGAGTGGGACGG - Intronic
1104068670 12:125326697-125326719 TGGTGCAACCAGGACAGGGATGG + Intronic
1104195665 12:126534893-126534915 AGGAGGAGGCTGGACAGAGAAGG + Intergenic
1104271084 12:127282825-127282847 AGTGGGGAGCAGGTGAGGGATGG - Intergenic
1104800779 12:131554146-131554168 AGGGGAGAGGAGGACAGGGAAGG - Intergenic
1105369257 13:19788404-19788426 AGGTGGTAGTAGGACAGGTATGG - Intergenic
1105425981 13:20295582-20295604 AGGGAGCAGGAGGACAGGGAGGG + Intergenic
1105494898 13:20921869-20921891 ATGGGGATCCAGGACAGGGCTGG + Intergenic
1105780889 13:23704635-23704657 AGGAGGGAGAAGGAGAGGGAGGG - Intergenic
1105981347 13:25519315-25519337 AGGGGAAAACAGATCAGGGAAGG - Intronic
1106124603 13:26890019-26890041 ATGAGGAAGGGGGACAGGGAAGG + Intergenic
1106220627 13:27743747-27743769 AGGGAGCACCAGGACAGTGACGG - Intergenic
1106693014 13:32139340-32139362 AGGGGTAAGGAAGGCAGGGAAGG - Intronic
1106740796 13:32638830-32638852 ATGGGGAAGGAGGGAAGGGAGGG + Intronic
1106871435 13:34026127-34026149 ATGGGGCAGCAGGAGAGGAAGGG + Intergenic
1107314203 13:39113553-39113575 AAAGGAAAGCAGGAAAGGGATGG - Intergenic
1107788491 13:43977809-43977831 AGGGGGAGGGAGGGAAGGGAGGG - Intergenic
1107918961 13:45183457-45183479 AAAGGGAAGCAAGACGGGGAAGG + Intronic
1107943575 13:45396796-45396818 AGTGGGAGGCAGGAAAGGAAAGG - Intronic
1108347521 13:49560925-49560947 AGGGGGTGGCATGCCAGGGAGGG - Intronic
1108396682 13:49996997-49997019 AAGGGGAAGCGGGAGAGGGAAGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1109055676 13:57545099-57545121 TGGTGGAAGCAGGACAGAGGTGG - Intergenic
1109658828 13:65431438-65431460 AGAGGGAGGTGGGACAGGGAAGG + Intergenic
1109710474 13:66152571-66152593 AGGGGGAGGGAAGGCAGGGAAGG + Intergenic
1110563005 13:76929354-76929376 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1110916905 13:81031715-81031737 AAGGGGAAGCAAGAGAGTGAAGG + Intergenic
1111396346 13:87672929-87672951 AAGGGGAGGGAGGAGAGGGAAGG - Intronic
1112038170 13:95517078-95517100 GGGAGGGAGGAGGACAGGGAAGG - Intronic
1112250447 13:97774471-97774493 AGATGGAAGAAGGAGAGGGAGGG - Intergenic
1112437322 13:99399679-99399701 AGGGGGCAGTAGGAGAGGGGAGG - Intergenic
1112735010 13:102406621-102406643 AGCAGGGAGCAGGACAGAGAAGG - Intergenic
1113127665 13:106998119-106998141 AGGAGGAAGAAAGAGAGGGAGGG - Intergenic
1113129319 13:107017677-107017699 AGATGGAAGCAGCACTGGGAAGG - Intergenic
1113179792 13:107612097-107612119 AGGGGGAGGGAGGAAGGGGAGGG + Intronic
1113655618 13:112066708-112066730 AGGGGGGAGGAGGCCCGGGAGGG - Intergenic
1113670261 13:112171227-112171249 AGGAGGAATCAGGACAGGCCAGG + Intergenic
1113754746 13:112803722-112803744 GAGGGGAAGGAGGTCAGGGAGGG - Intronic
1113811886 13:113147674-113147696 AGTGGGGAGGAGGACGGGGAGGG + Intronic
1114004751 14:18300430-18300452 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1114654439 14:24307703-24307725 AGTGGGGAGCAGGAGAGGAAGGG + Exonic
1114669521 14:24401408-24401430 TTGGAGAAGGAGGACAGGGAAGG + Intronic
1114673974 14:24429196-24429218 AGTGGGAGGCAGGACAGAGCTGG - Exonic
1114753967 14:25237657-25237679 ATGAGGAAGCAGGACAGGAAAGG - Intergenic
1114949458 14:27730512-27730534 AGTGGGAACCAGGACTGGAATGG - Intergenic
1115834143 14:37378626-37378648 GGAGGGAAGGAGGAAAGGGAGGG + Intronic
1115874486 14:37845034-37845056 AGAGGGAGGTAAGACAGGGAAGG - Intronic
1116479948 14:45385494-45385516 TGGGGAAAGCGGGACAAGGAAGG + Intergenic
1117459338 14:55929242-55929264 AGGAGGAAGGAGAAAAGGGAAGG + Intergenic
1118327919 14:64793879-64793901 AGGGGGAAGGAGGACAAAGTGGG + Intronic
1118387042 14:65264622-65264644 AGGAGGAGGAAGGACAGGCAAGG + Intergenic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118731356 14:68669340-68669362 AGAGGGAAGCAGGGGAGGCAGGG - Intronic
1118838514 14:69493942-69493964 AGGGGGAAGCAGCATATGCAGGG + Intronic
1119377450 14:74206346-74206368 TGGGGGAAGGAGGGAAGGGAAGG - Intergenic
1119764385 14:77179271-77179293 AGGGGAGGGCAGGAGAGGGAAGG - Intronic
1120101164 14:80447220-80447242 AGGAGGAAACAGGTCAGGCATGG - Intergenic
1120146814 14:80987881-80987903 GGGGCGAAGTAGGAAAGGGAAGG - Intronic
1120534952 14:85683324-85683346 AGAGGGAGCCAGGGCAGGGAAGG + Intergenic
1120832377 14:89008812-89008834 TGGGGGAAGGAGGAGAGGTATGG - Intergenic
1121137223 14:91509965-91509987 AGGCGGGAGCAGGGCAGTGACGG - Exonic
1121498357 14:94413473-94413495 CCAGGGAAGCAGGACAGGGGAGG - Intergenic
1121647042 14:95525711-95525733 AGGGGGAAGGAGGATTGGAAAGG - Intergenic
1121994766 14:98593341-98593363 AGGGGCAGGGAGGAGAGGGAAGG - Intergenic
1122007764 14:98719275-98719297 AGGGGAGAGGAGGCCAGGGAAGG + Intergenic
1122031958 14:98918942-98918964 AGGGGGAGGCCAGAGAGGGAGGG - Intergenic
1122115886 14:99527018-99527040 GGGAGGATGCAGGACAGGGCAGG + Intronic
1122282003 14:100629102-100629124 AGCAGGAAGCAGAACAGGGAAGG + Intergenic
1122359431 14:101150841-101150863 AGGGGGAAGGAAGGGAGGGAGGG - Intergenic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1122392546 14:101400026-101400048 AGAGGGAAGGAGGAAAGGGAGGG + Intergenic
1122487989 14:102094535-102094557 AAGGGCATGCAGGAGAGGGAGGG + Intronic
1122634900 14:103125231-103125253 AGGGGGAAGCAGGCAGGGGCTGG - Intronic
1122778603 14:104134218-104134240 AGGTGGACCCGGGACAGGGACGG - Intergenic
1123003170 14:105307454-105307476 AGGGCCAGTCAGGACAGGGAGGG - Exonic
1202862462 14_GL000225v1_random:90944-90966 AGGGAGAAGCCGGCCTGGGAGGG + Intergenic
1123389211 15:19852676-19852698 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1124357618 15:29008222-29008244 AGGGGCTAGAAGGAGAGGGAAGG + Intronic
1124529185 15:30488597-30488619 AGGGGGAAGAAGGAAATGGAGGG - Intergenic
1124603229 15:31151697-31151719 AGGAGGATGTGGGACAGGGAGGG - Intronic
1124769477 15:32519096-32519118 AGGGGGAAGAAGGAAATGGAGGG + Intergenic
1125697466 15:41651538-41651560 AAGGGGAAGATGTACAGGGAAGG - Intronic
1125833398 15:42731414-42731436 AGGGAGCAGCAGGACAGACAGGG + Intronic
1125886781 15:43235312-43235334 AGGGGGAAGGAGAAGAGGGAAGG + Intronic
1126315719 15:47367226-47367248 GGGGGGAAGGAGGACAGTCAGGG - Intronic
1126339391 15:47622643-47622665 AGGGGGTTGCAGGACAGGAAAGG + Intronic
1126792179 15:52231335-52231357 AGGGCGAGGCAGGCCAGTGAAGG - Intronic
1126890657 15:53200842-53200864 AGGCTGAGGCAGGAGAGGGAGGG + Intergenic
1127051818 15:55091562-55091584 TGGGGAAAGAAGGACAGGGAAGG - Intergenic
1127262135 15:57334412-57334434 GGGAGGAAGCAGTACAGGGCGGG + Intergenic
1127462913 15:59216054-59216076 AGGGTCAGGCAGGACAGGGTAGG - Intronic
1127546869 15:60000499-60000521 AGGGGAAAGAAGGAGAGGGAGGG + Intergenic
1127623482 15:60757373-60757395 AGGGGAAGACAGGACTGGGAAGG - Intronic
1128060831 15:64734842-64734864 AGGTGAAAGAAGGACAGGGTGGG - Intergenic
1128237988 15:66080450-66080472 AGGAGGAGGCAGGAGAGGAAAGG - Intronic
1128313270 15:66644845-66644867 AGGGGGCAGCGGAACAGGGCTGG - Intronic
1128314297 15:66650607-66650629 ATGGGGAAGTGGGACAGGGAGGG + Intronic
1128419043 15:67474114-67474136 AGAGGGATGCAGGAGAGGAAAGG + Intronic
1128726799 15:69993974-69993996 AGGAGGAAGAAGGAGAGGGGAGG - Intergenic
1128811482 15:70576119-70576141 ATGGGGAAGCAGGAAAGAGTTGG + Intergenic
1129054444 15:72808973-72808995 GCAGGGAAGCAGGACAGGGAAGG + Intergenic
1129063489 15:72880804-72880826 AGGGGAAAGCAGGGGAGGGGAGG + Intergenic
1129090863 15:73148937-73148959 AGATGGAAGCAGGGCAGGGTAGG + Intronic
1129104413 15:73296303-73296325 AGGGAGAAGCTGGGCAGGGTAGG - Intronic
1129184986 15:73900483-73900505 AGGAGAAAGCAGGACAGGTAGGG - Intergenic
1129329052 15:74817441-74817463 AGAGGGAGGCAGCACAGGGCAGG - Intronic
1129384049 15:75185867-75185889 CGGGGGAAGGAGGGAAGGGAGGG + Intergenic
1129666911 15:77584512-77584534 AGGGGGAAGTGAGACAGAGAAGG - Intergenic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1129832406 15:78679434-78679456 AGGCTGAGGCAGGACAGGGCAGG + Intronic
1129848311 15:78778097-78778119 TGGGGGAAACGGGACAGGCATGG - Intronic
1130102197 15:80902515-80902537 AGGCGGCAGCAGGACAGATAAGG + Intronic
1130103452 15:80911792-80911814 AGGGGGAAGCGGCACAAGAATGG + Intronic
1130411109 15:83649469-83649491 TGAGGGAAGCAGGATAGGTAAGG - Intergenic
1130793969 15:87188916-87188938 GTGGGGAAGAAGGACAGGCAGGG + Intergenic
1130838069 15:87671414-87671436 AGGGGGAATCAAGGCAGGCACGG - Intergenic
1130856044 15:87840901-87840923 AGGAGGGAGGAGGAGAGGGAGGG + Intergenic
1130883848 15:88077408-88077430 TGGGGGAGGCAGGGCTGGGAAGG - Intronic
1130959930 15:88652629-88652651 AGGGAGGAGGAGGAAAGGGAGGG - Intronic
1131051904 15:89353963-89353985 TGGGGGAAGCAGGCCAGGGAAGG + Intergenic
1131052887 15:89359882-89359904 AGGGGGTAGCACAGCAGGGAGGG - Intergenic
1131179141 15:90228408-90228430 AGGGGGCAGCACCACAGGGCAGG - Exonic
1131269040 15:90935422-90935444 GGGGAGAAGGAGGCCAGGGATGG - Intronic
1131413239 15:92228826-92228848 AAGGGGAAGCAGAACAAGAAAGG + Intergenic
1131665649 15:94568536-94568558 AGGAGGAGGCAGGACAGAGGAGG + Intergenic
1132073676 15:98801353-98801375 AGCAGGAAGCAGTGCAGGGAGGG - Intronic
1132104327 15:99051756-99051778 ATGGGGAAGGGAGACAGGGAAGG - Intergenic
1132145896 15:99429751-99429773 AGGGGGAAGCAGGGGAGGAGGGG + Intergenic
1132303399 15:100790188-100790210 ACTGAGAAGCAAGACAGGGATGG + Intergenic
1132305131 15:100806619-100806641 AGGGAGAGGAAGGAGAGGGACGG + Intergenic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1132352178 15:101146693-101146715 AGAAGGAAGGAGGACAGGGAGGG + Intergenic
1132621078 16:868584-868606 AGAGGCAAGAAGGACAGGCAGGG - Intronic
1132653417 16:1031580-1031602 AGGGCTCAGCAGGGCAGGGAGGG + Intergenic
1132739653 16:1405251-1405273 AGAGGAAAGAAAGACAGGGAGGG + Intronic
1132752553 16:1465481-1465503 TGGGGGCAGCAGGGCTGGGACGG + Intronic
1132804873 16:1770834-1770856 AGGGGGAGGCCGGACGGGGCTGG + Intronic
1132816768 16:1832775-1832797 ATGGGGAGGGTGGACAGGGAAGG - Intronic
1133013590 16:2928777-2928799 ATGGGGAACCAGCACAGGGCTGG - Intronic
1133207069 16:4240182-4240204 AGGAGCAAGCATGATAGGGAGGG + Intronic
1133464578 16:6018184-6018206 AGGAGGAAGGAAGAAAGGGAGGG + Intergenic
1133485559 16:6215228-6215250 GAGGGGAAGAAGGAGAGGGAAGG + Intronic
1133594030 16:7273093-7273115 AGAGGGAAGGAGGAAAGGGAGGG - Intronic
1133656708 16:7872039-7872061 GGAGGGAAGAAGGACAGGGAAGG - Intergenic
1133810627 16:9158444-9158466 GGGGCGGGGCAGGACAGGGAAGG - Intergenic
1133890925 16:9877824-9877846 GAGGGATAGCAGGACAGGGAGGG - Intronic
1133966409 16:10535202-10535224 AGTTTGAAGCAGAACAGGGAGGG + Intronic
1134043824 16:11087213-11087235 AGGGGGCAGCAGGTGGGGGATGG - Intronic
1134066599 16:11232468-11232490 AGGGGGGAGGAGGAGGGGGAGGG + Intergenic
1134242453 16:12515986-12516008 AAGGGGAAGCAGGGGAGGGGAGG + Intronic
1134297717 16:12961624-12961646 AGGGGGAAGAAGGAGAAAGAAGG + Intronic
1134305740 16:13030488-13030510 ACGGGGAAGTTAGACAGGGAAGG - Intronic
1134386303 16:13776596-13776618 AAGGGGAAGCAAGACAAAGAAGG + Intergenic
1134401405 16:13913672-13913694 TGGGGGAAGCAGAACAGGAAAGG - Intergenic
1134692065 16:16197613-16197635 AGGGGGAAGGAGGAAAAGGAAGG + Intronic
1134745764 16:16587175-16587197 ATGTGGAAGCAGGCCAGGGCAGG - Intergenic
1134765689 16:16755709-16755731 AAGGGGAAGAAGGAGAGGAAGGG - Intergenic
1134891573 16:17845913-17845935 ACGGGGAAGGAGGACAGGGAGGG + Intergenic
1134980361 16:18603504-18603526 AAGGGGAAGAAGGAGAGGAAGGG + Intergenic
1134999717 16:18766567-18766589 ATGTGGAAGCAGGCCAGGGCAGG + Intergenic
1135230445 16:20701683-20701705 AGGGGTGAGGAGGAAAGGGAGGG - Intronic
1135358364 16:21789882-21789904 AGGAGGAACCAGGGCAGGGAAGG + Intergenic
1135456867 16:22606007-22606029 AGGAGGAACCAGGGCAGGGAAGG + Intergenic
1135585185 16:23664988-23665010 AGAGGAAAGCAGCACAGAGATGG - Intronic
1135698453 16:24610689-24610711 AGGGAGAGGGAGGACAGCGAAGG - Intergenic
1135950539 16:26910063-26910085 GGGGGACAGTAGGACAGGGAAGG - Intergenic
1136073668 16:27804202-27804224 GGCAGGAGGCAGGACAGGGACGG - Intronic
1136229002 16:28876230-28876252 AGGGGGAAACAAGCCAGGGAGGG - Intergenic
1136289685 16:29264174-29264196 AGGAGCAAGGAGGGCAGGGAGGG - Intergenic
1136289720 16:29264298-29264320 AGGAGCAAGGAGGGCAGGGAGGG - Intergenic
1136360959 16:29779478-29779500 AGGGGCAAGCAGGAGTTGGAGGG - Intronic
1136416432 16:30107055-30107077 AGGGAGAGGGAGGAGAGGGAGGG - Intronic
1136989435 16:35143057-35143079 AGGGGGAAGCATGAGTGGGGGGG - Intergenic
1137536091 16:49327371-49327393 AGGGAGAAGTTAGACAGGGAAGG - Intergenic
1137544876 16:49395869-49395891 AGGGGGAAGGAGGGAAAGGAAGG + Intronic
1137610533 16:49814363-49814385 GAGGGCAAGCAGGACAGGGGTGG + Intronic
1137610567 16:49814511-49814533 GAGGGCAAGCAGGACAGGCATGG + Intronic
1137639254 16:50013928-50013950 ATGGTGAAGCAGGGGAGGGAAGG - Intergenic
1137687199 16:50394449-50394471 AGGGGAAAGAAGGGAAGGGAAGG - Intergenic
1137749223 16:50846545-50846567 AGGGGAGAGCAGGACATGGGTGG - Intergenic
1137767832 16:50991511-50991533 AGAGGGGGGCAGGAGAGGGAAGG + Intergenic
1137807282 16:51319351-51319373 TGGAAGAAGCAGGACAGGGAAGG - Intergenic
1137836136 16:51594370-51594392 AGGGGAGAGCAGGAGAGGCAAGG - Intergenic
1137921963 16:52498762-52498784 ACGGGGAAGCAGGATATGCACGG - Intronic
1137962619 16:52898161-52898183 AGTGGGAAGTAAGACAAGGATGG - Intergenic
1138204743 16:55116237-55116259 AGAAGGAAGCAGGCCAAGGAAGG + Intergenic
1138276088 16:55736066-55736088 AGAGGGATGGGGGACAGGGAAGG + Intergenic
1138446914 16:57070383-57070405 ATGGGGAACCTGGACAGCGAGGG + Intronic
1138498390 16:57423042-57423064 GGGAGGAAGGAGGAAAGGGAGGG + Intergenic
1138523485 16:57587321-57587343 AGGGGGAAGGAAGGGAGGGAGGG - Intronic
1138557263 16:57779166-57779188 AGGTGGAAGCAGCCCATGGATGG + Intronic
1138574763 16:57900611-57900633 AGGGTGAAGCTGAGCAGGGAGGG + Intronic
1138605118 16:58083707-58083729 AGTGAGAAGCAGGGCAGGGCTGG + Intergenic
1138641853 16:58393895-58393917 AGGGGGAAGTGGGAAAAGGAAGG - Intronic
1138667759 16:58586380-58586402 AGGGGGAGGGAGGGCAGGGGAGG + Intronic
1139004229 16:62551413-62551435 AGGGGATGGAAGGACAGGGAAGG - Intergenic
1139004276 16:62551563-62551585 AAGGGGAAAAAGGAAAGGGAAGG - Intergenic
1139425042 16:66874007-66874029 AGGAGGAAGGAGGAGAGGGGAGG - Intergenic
1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG + Intronic
1139558517 16:67727654-67727676 AGGGGGCAGCAGGAAAGAGTGGG - Intronic
1139918959 16:70446899-70446921 TGGGGAAAGCAGGATAGGGCAGG - Intergenic
1140025884 16:71289657-71289679 AGGGGGAGGGAGGGAAGGGACGG + Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140533139 16:75684130-75684152 AGGGTGAAGTTGCACAGGGATGG + Intronic
1140774994 16:78241320-78241342 AGGAGGAAGCAGACCAAGGAGGG - Intronic
1141008003 16:80371327-80371349 ACGGGAAAACAGGACTGGGAAGG + Intergenic
1141440634 16:84027564-84027586 AGAGGGCTGCAGGAAAGGGACGG - Intronic
1141480052 16:84300415-84300437 AGTGGGAAGCTGGGCAGGAAAGG - Intronic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1141678117 16:85528279-85528301 TTGGGGGAGCAGGGCAGGGATGG + Intergenic
1141713912 16:85716278-85716300 GGAGGGAAGGAGGAGAGGGAAGG + Intronic
1141809022 16:86361805-86361827 CAGTGGAAGCAGGACAGAGAAGG - Intergenic
1141812532 16:86385144-86385166 ATGGGGACCCAGGCCAGGGATGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141883333 16:86874403-86874425 GTGGGGAGGCAGGACAGGGAAGG - Intergenic
1142027996 16:87824668-87824690 AGGGGGATGCAGAAGAGGGTGGG - Intergenic
1142095422 16:88237154-88237176 AGGAGCAAGGAGGGCAGGGAGGG - Intergenic
1142095519 16:88237495-88237517 AGGAGCAAGGAGGGCAGGGAGGG - Intergenic
1142095554 16:88237619-88237641 AGGAGCAAGGAGGGCAGGGAGGG - Intergenic
1142095589 16:88237743-88237765 AGGAGCAAGGAGGGCAGGGAGGG - Intergenic
1142432483 16:90037456-90037478 AGGGAGGAGCATCACAGGGAGGG + Intronic
1142601213 17:1053795-1053817 AACGGGAAGCAGGAGAGGGAGGG + Intronic
1142714147 17:1738834-1738856 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714259 17:1739329-1739351 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714280 17:1739419-1739441 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714330 17:1739642-1739664 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714394 17:1739912-1739934 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714437 17:1740092-1740114 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714521 17:1740452-1740474 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714760 17:1741442-1741464 AGTGAGGAGCAGGACAGTGAAGG + Intergenic
1142714790 17:1741577-1741599 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714810 17:1741667-1741689 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714833 17:1741757-1741779 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714886 17:1741980-1742002 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714898 17:1742025-1742047 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142759571 17:2034852-2034874 ATGGGGCAGCAGGGGAGGGAGGG - Intronic
1143096489 17:4481058-4481080 GAGGGGAAGCAGGACACCGAGGG + Intronic
1143323375 17:6082290-6082312 CGCGGGAAGTGGGACAGGGAAGG + Intronic
1143373782 17:6455693-6455715 AGGGGGAAGAAGGGAGGGGAGGG + Intronic
1143377370 17:6474615-6474637 AGGAGGACGCAGGGCAGGGCAGG + Intronic
1143403561 17:6661075-6661097 AGGGAGAGGCAGGAGTGGGATGG + Intergenic
1143502468 17:7347329-7347351 AGAGGAAGCCAGGACAGGGAAGG - Intronic
1143608236 17:8003117-8003139 CGGGGGAGGCGGGGCAGGGACGG - Exonic
1143707784 17:8711531-8711553 AGTGGGAATCAGGAGAGGGAGGG - Intergenic
1143735946 17:8912115-8912137 ATGAGGAAGGAGGGCAGGGAAGG - Intronic
1143794692 17:9327226-9327248 AGGAGGAAGGAGGACAGAGGAGG + Intronic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143965892 17:10756286-10756308 AGGGGGCCGAAGGAGAGGGAGGG - Intergenic
1144149715 17:12431487-12431509 AGGTGGAAGGAGTACAGGGAAGG - Intergenic
1144563818 17:16343749-16343771 TGGGGGAGGCAGGGCAGGGCAGG - Intronic
1144594041 17:16551157-16551179 AAGGGGAAGTAAAACAGGGAAGG + Intergenic
1144711791 17:17406079-17406101 ATGAGGAAGCAGCCCAGGGAGGG - Intergenic
1144747560 17:17626075-17626097 AGAGGGAGGCAGGGCAGGGGTGG - Intergenic
1144749607 17:17639336-17639358 ATGGGGAAGCAGGCCATGGGTGG + Intergenic
1144827204 17:18112188-18112210 GGGGAGAAGCAGGGCAGGGCTGG - Intronic
1145124014 17:20285756-20285778 AGAAGGAGGGAGGACAGGGAGGG - Intronic
1145209858 17:21004812-21004834 AGCGGGAAGCAGGTCAGTGGCGG + Intronic
1145736799 17:27238799-27238821 TGGGCCAAGCAGGGCAGGGAGGG + Intergenic
1145765526 17:27456287-27456309 AGGGGAGAGGAGGGCAGGGAGGG + Intergenic
1145844835 17:28029533-28029555 ATGGGGAAGTGAGACAGGGAAGG - Intergenic
1146093253 17:29903568-29903590 AGGGAGATGCAGAACAGAGAAGG - Intronic
1146351252 17:32096212-32096234 AGGGTGAAGCGGGCCAGGCACGG + Intergenic
1146846920 17:36187965-36187987 AGAGAGAAGCAGGACTTGGAGGG - Intronic
1146912490 17:36657794-36657816 AGGAAGAAGAAGGAAAGGGAGGG + Intergenic
1147203963 17:38823606-38823628 GGGGAGAGGCAGGACAAGGAGGG - Intronic
1147314349 17:39612462-39612484 TGGGGGGAGGAGGAAAGGGAGGG + Intergenic
1147325913 17:39669543-39669565 AGGGAGATGCAGGGGAGGGAAGG + Intronic
1147328232 17:39680472-39680494 CGTGGGAAGGAGGTCAGGGAAGG - Intronic
1147606414 17:41776154-41776176 AGGGCGGAGCAGGGCAGGGCTGG + Intronic
1147626586 17:41904306-41904328 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1147791715 17:43017987-43018009 AGGGAGGCACAGGACAGGGAGGG - Intronic
1147976613 17:44251546-44251568 AGGGGGATGCGGGACAGGATGGG + Exonic
1148074376 17:44927079-44927101 CTGGGGAGGGAGGACAGGGAAGG + Intronic
1148460668 17:47837543-47837565 ACTGGGCAGGAGGACAGGGAGGG - Exonic
1148638373 17:49166347-49166369 AGGGGGAGGGAGGGGAGGGAGGG + Intronic
1148677830 17:49455397-49455419 AGCGGGAAGTGGGAGAGGGAGGG - Intronic
1148741700 17:49896977-49896999 AGGGAGAAGCAGGACAGAGCTGG - Intergenic
1148824709 17:50384044-50384066 AGGGAGAGGCAGGTGAGGGAAGG - Intronic
1148863003 17:50614297-50614319 AGGGGGAAGCCAGCCAGTGAGGG - Intronic
1148872836 17:50668756-50668778 AGGGGAAAGGAGGACAGGGGAGG - Intronic
1148896297 17:50841041-50841063 AGGTGGAAGAAGGCCAGGGAGGG - Exonic
1149376256 17:56047234-56047256 AGAAAGAAGCAGGGCAGGGAGGG - Intergenic
1149594289 17:57855027-57855049 AGGAGGATGAAGGGCAGGGAGGG + Intergenic
1149658116 17:58320717-58320739 AGAGGGAAGAGGGATAGGGAAGG + Intronic
1150001535 17:61443650-61443672 AGGGGGAAGCGGGTGAGGGTGGG - Intergenic
1150138114 17:62706876-62706898 AAAGGGAAGGAGGAGAGGGAAGG + Intronic
1150170427 17:62987808-62987830 AGGGGCAAGGAGTACAGGGAAGG + Intergenic
1150222024 17:63501107-63501129 AGGCGGAAGCGACACAGGGAGGG - Intronic
1150434055 17:65140441-65140463 AGTGGGAAGCTGGAAAGGAAAGG + Intronic
1150449469 17:65254301-65254323 TCGGGGAAGCAGGACAGGCAAGG + Intergenic
1150493261 17:65588837-65588859 AAGGGGAAGGGGGAAAGGGATGG - Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1151145229 17:72034388-72034410 AGGGGGAAGCAGGAGGGACATGG - Intergenic
1151352381 17:73539444-73539466 AGAGGCCAGCAGGAGAGGGAGGG + Intronic
1151484998 17:74393493-74393515 AGTGTGAACCAAGACAGGGATGG - Intergenic
1151553611 17:74835721-74835743 AGGGGAGAACAGGACAGAGAGGG + Intronic
1151560594 17:74867581-74867603 GGGGAGCAGCAGGACAGGGAGGG + Intronic
1151898808 17:76998097-76998119 TGGGGAAAGCAGAACAGGGACGG + Intergenic
1151933838 17:77249272-77249294 AGGTGGACGCTGGACAGGGCAGG - Intergenic
1151962898 17:77416589-77416611 CGGAGGATGCAGGACTGGGAAGG - Intronic
1152231814 17:79117654-79117676 TGGGGGAGGCAGGACAGAGGTGG - Intronic
1152310149 17:79545070-79545092 GGGGGGAAGGAGCACAGGAAGGG + Intergenic
1152368837 17:79872507-79872529 AGGGGAAAGCAGGGGAGGGGAGG - Intergenic
1152368851 17:79872536-79872558 AGGGGAAAGCAGGGGAGGGGAGG - Intergenic
1152400796 17:80065129-80065151 AGGGAGAAGGGGGAGAGGGAGGG - Intronic
1152590412 17:81208852-81208874 AGGGAGGAGCAGGCCAGGGTGGG + Intronic
1152628106 17:81397541-81397563 AAGGGAAAGAAGGAAAGGGAGGG - Intronic
1152650824 17:81491831-81491853 AGGGGGGAGGGGGAGAGGGAGGG - Intergenic
1152655820 17:81518828-81518850 AAGGGGAAGCGGGTCAGGGCGGG + Intronic
1152689231 17:81710422-81710444 TGGGGGAAGCAGGGCCTGGAGGG - Intergenic
1152870415 17:82750932-82750954 AGGGGGACGGGGGACAGGGATGG - Exonic
1153303385 18:3611277-3611299 AGGGGGATGCGGGCCTGGGATGG - Intronic
1153435438 18:5063424-5063446 AGTGGGAAGGAGGACTGGGCAGG + Intergenic
1153537072 18:6113964-6113986 AGGAGGAAGGACGAGAGGGAAGG - Intronic
1154092420 18:11378185-11378207 AGGAGGAAGGAGGACAGAGGAGG - Intergenic
1154167188 18:12024729-12024751 AGAGGGAGGAAGGGCAGGGAGGG - Intronic
1154532676 18:15363438-15363460 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1155898642 18:31360848-31360870 AGGGAGAGGAAGGAAAGGGAAGG - Intergenic
1156214712 18:34984614-34984636 GGGGGAAAGGAGGAAAGGGATGG + Intronic
1156486477 18:37469205-37469227 AGGGGTAAGCAAGTCAGGCAAGG - Intronic
1156491339 18:37498295-37498317 AGGGGAAAGGAGGGAAGGGAAGG - Intronic
1156523741 18:37746636-37746658 AGAGTGAGGCAGGGCAGGGAGGG + Intergenic
1156601707 18:38614929-38614951 AGGTGGAAGCAAGAAAGAGATGG - Intergenic
1157297016 18:46452889-46452911 AAGGGGGAGGTGGACAGGGAGGG - Intronic
1157303664 18:46500082-46500104 AGGGGGAAGAAGAAAAGAGAAGG - Intronic
1157338225 18:46756700-46756722 GGCGGCAAGCAGGACAGGGCCGG + Exonic
1157499021 18:48177224-48177246 AGGGTGAAGCAGGAGGGCGAGGG - Intronic
1157710319 18:49845742-49845764 AGGGGGATGCTGGACTGGGTTGG + Intronic
1157893215 18:51438645-51438667 AGAGGGCAGGAGGCCAGGGATGG + Intergenic
1158339441 18:56449659-56449681 TCCGGGAAGCAGGACAGAGAAGG + Intergenic
1158471834 18:57743840-57743862 AGGGGGAAGGGTGACTGGGAAGG + Intronic
1158600680 18:58853360-58853382 AGGAGGAAGGAAGAAAGGGAGGG + Intergenic
1158610429 18:58935285-58935307 AGGGGGAGGAGGGAGAGGGAAGG - Intronic
1158868270 18:61659055-61659077 AGAGGGAGGCAGGAGAGCGAGGG + Intergenic
1158928766 18:62299802-62299824 AGGGAGAAGTAGGTCAGGTATGG - Intronic
1159003257 18:62991626-62991648 AGTGGGAAGGAGGTCAGAGAAGG + Intergenic
1159301000 18:66567359-66567381 AAGGGGGAGGAGGAGAGGGAGGG + Intronic
1159482224 18:69004293-69004315 AGGGAGAAGTAGGACTGGGAGGG + Intronic
1159520721 18:69518273-69518295 AGGAGGAAGAAGGAAAGGGAAGG - Intronic
1159607443 18:70489760-70489782 AGGGGGAAGGAAGAGAGAGAAGG - Intergenic
1159654987 18:71022611-71022633 AGAGGGAGGCAGGAGAGTGAGGG - Intergenic
1160237673 18:77098942-77098964 AGGGGGAAGGAGGAGTGAGAAGG - Intronic
1160304508 18:77719099-77719121 TGGGGTAAGCAGGCCAGGGATGG + Intergenic
1160622877 18:80182961-80182983 AGGACGAAGGAGGACTGGGAGGG - Intronic
1160692809 19:467567-467589 AGGGGGAGGGAGGACAGGGCAGG + Intronic
1160726725 19:620829-620851 AGGGAGAAGCAGGACGGGCAGGG + Intronic
1160867612 19:1262730-1262752 GGGCGGAAGCAGGGGAGGGACGG - Intronic
1160951562 19:1670000-1670022 AGGGGGAGGGAGGGAAGGGAAGG - Intergenic
1161030743 19:2056737-2056759 AGGGGGGAGGAGGAGAGGGGAGG - Intergenic
1161340969 19:3742009-3742031 AGGGGACAGAAGGACAGGAAGGG + Intronic
1161370575 19:3908753-3908775 AGGGGGGAGGAGGAGAGGGAAGG - Intronic
1161452270 19:4353044-4353066 GAGGGGAGGCAGGACAGGGGCGG + Intronic
1161518698 19:4711480-4711502 AGAGGGAGGCAGGCCAGGCACGG + Intronic
1161753939 19:6117725-6117747 AGGGGGAAGAAGGGAAGAGAGGG + Intronic
1161951977 19:7472606-7472628 AGCGTTAAGCAGGACACGGAGGG - Intergenic
1162153426 19:8661048-8661070 AGGGGGAAGGAAGGGAGGGAGGG - Intergenic
1162153435 19:8661067-8661089 AGGGGGAAGGAAGGGAGGGAGGG - Intergenic
1162332642 19:10039553-10039575 AGGAAGGAGCAGGACTGGGAGGG + Intergenic
1162762559 19:12897230-12897252 AGGGGGCCCCAGGACAGGGACGG + Intronic
1162877086 19:13628346-13628368 AGGGGAGAGGAGGAGAGGGAAGG + Intergenic
1162985522 19:14266965-14266987 AGGAGGAGGAAGGACAGGGGTGG + Intergenic
1163202702 19:15780005-15780027 GGGTGGAGGCAGGAAAGGGAGGG + Intergenic
1163287456 19:16357533-16357555 AGCGGGAAGCAGGAGAGAGGAGG + Intronic
1163339301 19:16694418-16694440 TGGGGAAAGAAGGACAGGGTAGG + Intergenic
1163359521 19:16837054-16837076 AGGATGGAGCAGGCCAGGGAAGG + Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163770593 19:19188784-19188806 AAGGGGAAACAGGGCAGGGCTGG - Intronic
1164753304 19:30671551-30671573 AAGGGGAAGCGGGGCAGGGGTGG + Intronic
1164787222 19:30943069-30943091 AGGGGCAGACAGGACAAGGAAGG + Intergenic
1164787454 19:30944798-30944820 AGGGGGAGGGAGGGAAGGGAGGG + Intergenic
1165042940 19:33081697-33081719 AGGGGCAGGCAGGACGGGTATGG + Intronic
1165087838 19:33363724-33363746 AGAGGGAAGTGGGAGAGGGAAGG - Intergenic
1165307997 19:35013818-35013840 ATGGAGGAACAGGACAGGGAGGG + Intronic
1165325381 19:35111619-35111641 ACAGGGAAGCAGGAAAGGGCAGG - Intergenic
1165376497 19:35446512-35446534 AGGGGGACTCACGACAGTGACGG + Intronic
1165401088 19:35600784-35600806 AGGGGCAAGATGGAGAGGGAGGG - Intergenic
1165419469 19:35715837-35715859 AGGTGTATGCAGGACAGCGAGGG - Intronic
1165422748 19:35730491-35730513 AGAGGCAGGCAGGACAGGGTAGG - Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165828491 19:38719022-38719044 AGGGGGAGCCAGGCCCGGGAAGG - Intronic
1166296626 19:41893156-41893178 AGGGGGAAGAGAGACAGAGAGGG - Intronic
1166316627 19:41993160-41993182 AGGGGGAATCAGGAGAGGAGGGG - Intronic
1166329333 19:42069508-42069530 AGGGGGAAGGAGCAAATGGAGGG + Intronic
1166399385 19:42466888-42466910 AGAGGCAGGCAGAACAGGGAGGG - Intergenic
1166504524 19:43362603-43362625 AGGGGGCAGCAGGACACCCAGGG + Exonic
1166580660 19:43895802-43895824 AGGGTGGAGGAGGAGAGGGAGGG + Intronic
1166652145 19:44582693-44582715 AGGAGGAAGAAGGAGAAGGAGGG + Intergenic
1166747392 19:45147771-45147793 AGGGGGGAGCAGGCCGGGCATGG + Intronic
1166750166 19:45160789-45160811 AGCCGAAAGCAGGACAGGGAAGG + Intronic
1167220903 19:48197355-48197377 TGGGGGAAGCAGGAGAGGAAGGG + Exonic
1167245215 19:48369128-48369150 GGGGGGAAGGAGGAGAGGGCGGG - Intronic
1167270434 19:48502855-48502877 AGGGGGCAGCTGGACAAGGCCGG - Intronic
1167384880 19:49157505-49157527 AGGAGGATGCCAGACAGGGAGGG - Intergenic
1167428856 19:49443045-49443067 GGGTGGGAGCAGGACTGGGAGGG - Intergenic
1167568436 19:50271714-50271736 AGGGGGAGGAAGGTCAGAGAAGG + Intronic
1167723727 19:51197101-51197123 AGGGGGATGGGGGACAGGGGAGG - Intergenic
1167970113 19:53183898-53183920 CTGGGGGAGCAGGTCAGGGAGGG + Intronic
1168099647 19:54134215-54134237 AGAGGGAAGGTGGAGAGGGAGGG - Intergenic
1168296676 19:55380359-55380381 AGGGGGAAGCAGGGAGGGAAGGG - Intronic
1168670683 19:58238907-58238929 AGGGACAGGCAGAACAGGGAGGG + Intronic
925212494 2:2061906-2061928 AGCTGGAAGTAAGACAGGGATGG - Intronic
925251120 2:2439593-2439615 AGGGGTCAGCAGGGTAGGGAGGG + Intergenic
925306036 2:2848902-2848924 TGGGGGAAGGAAGCCAGGGAGGG + Intergenic
925545464 2:5011235-5011257 AGAAGGAAGGAGGAGAGGGAGGG - Intergenic
925575869 2:5359068-5359090 AAGGGGAAGCAGGAGAGAAAAGG + Intergenic
925743574 2:7026797-7026819 AGGGTGGAGCTGGACAGGGAGGG - Intronic
925818372 2:7775409-7775431 GGGGGGAAGGAGGGGAGGGAGGG + Intergenic
925920331 2:8633639-8633661 AGGGGGACGAAGGAGGGGGAAGG - Intergenic
926092030 2:10057642-10057664 AGGGGGAAGGAGGAGACAGAAGG - Exonic
926195762 2:10762826-10762848 AGGGGAGAGGAGGACAGGGGAGG - Intronic
926226996 2:10973832-10973854 AGGAGAAAGCAGGGCAGAGATGG + Intergenic
926395284 2:12435005-12435027 AGGGAGAAGCAGGACATGATAGG - Intergenic
926537156 2:14127560-14127582 ATGGTGAAGCAGGAGAGAGACGG + Intergenic
927215645 2:20666782-20666804 ATTGGGAACCAGGGCAGGGAGGG + Exonic
927551726 2:24007089-24007111 AGAGGGAAGCAGTTCAGGGCTGG + Intergenic
927659521 2:24981058-24981080 AGGGGGAGGGGGGAGAGGGAGGG + Intergenic
927863873 2:26576658-26576680 AGGGGGCTGCAGGGCAGGGAGGG - Intronic
927948382 2:27150843-27150865 AGCAGGCAGCAGTACAGGGAAGG + Intronic
928018285 2:27679908-27679930 TGAGGGAAGCAGGAGAGGGCAGG + Intronic
928075596 2:28261750-28261772 AGGGGAAAGGAGGAGAGGGGAGG - Intronic
928177788 2:29046773-29046795 AGGGGGAAGCAGCACAGCACAGG - Intronic
928333707 2:30377654-30377676 ATGGGGAAGTGGAACAGGGACGG - Intergenic
928406191 2:31016775-31016797 TGAGGGAAGCAAGACAGGGCAGG - Intronic
928649668 2:33391046-33391068 AGGGGAAGGAAGGACAAGGAGGG - Intronic
928713982 2:34039109-34039131 AGAGGGAAGAAGGAGGGGGAAGG - Intergenic
928823615 2:35392140-35392162 AGAGGGAAAGAGGACAGGGAGGG + Intergenic
928891952 2:36214710-36214732 AGGAGGAAGCAGGACTGGGGAGG + Intergenic
929237898 2:39625761-39625783 AGGGGAATGGAGGAGAGGGAAGG + Intergenic
929307303 2:40378207-40378229 AGGGGGAAACAGTATATGGAAGG + Intronic
929562215 2:42963028-42963050 CGAGGGATGGAGGACAGGGAGGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929846579 2:45535881-45535903 GGGGGGAAGCAGGAAAAGGAGGG + Intronic
929865127 2:45711029-45711051 AGGGGGACAGGGGACAGGGAGGG - Intronic
930063223 2:47308195-47308217 AGAAGGAAGCTGGTCAGGGAGGG - Intergenic
930312214 2:49755859-49755881 AGGGGGAAGGGAGAGAGGGAGGG + Intergenic
930891417 2:56392642-56392664 TGGGGGAAGTAGGAAAGGAAAGG + Intergenic
930945891 2:57075242-57075264 GAGGGGAAGCAAGACAGAGATGG + Intergenic
931607413 2:64066070-64066092 AGGGGGAGGAAGGAGACGGAGGG + Intergenic
932090222 2:68799743-68799765 TGGGGGAAGAAGGGCCGGGAGGG + Intronic
932091961 2:68813830-68813852 AGGGAGAAGAAGGACAGGGAGGG + Intronic
932434528 2:71695283-71695305 AGGAGGGAGGAGGACAGGGAAGG + Intergenic
933464168 2:82629836-82629858 AGGAGGAAGCAGGGTAGGAAGGG - Intergenic
934047333 2:88183594-88183616 AGAGGGAAGAAGGAGAGCGAGGG - Intronic
934907392 2:98217128-98217150 AGGGGGCAGGAGGACAGGAGTGG - Intronic
935130741 2:100259093-100259115 GGGGGGCAGCAGGAAAGGTAGGG + Intergenic
935192807 2:100792313-100792335 AGGGGAGGGCAGGACAGGAAGGG + Intergenic
935394207 2:102588351-102588373 GGGAGGAAGCAGGGCAGGCAAGG - Intergenic
935629618 2:105202378-105202400 ATGGTGAAGCAGGAGAGAGAGGG + Intergenic
936091835 2:109506514-109506536 AGGGTGGGGCAGGACAGGGTGGG + Intergenic
936122293 2:109757434-109757456 AGGGTGGGACAGGACAGGGAGGG - Intergenic
936154106 2:110037169-110037191 AAGGGGAAGAAGCAGAGGGAGGG - Intergenic
936190578 2:110334246-110334268 AAGGGGAAGAAGCAGAGGGAGGG + Intergenic
936222400 2:110614040-110614062 AGGGTGGGACAGGACAGGGAGGG + Intergenic
936379396 2:111970715-111970737 AGGGGGAGGAAGGACAAGGGAGG - Intronic
936447462 2:112607243-112607265 AGGGAGAAGGAGGAAAGGGAAGG - Intergenic
936496560 2:113027281-113027303 AGGGGGAGGCAGGAGAAGCAGGG + Intronic
936679299 2:114752218-114752240 AGGGGGAACCAGCACATGGCAGG - Intronic
936977878 2:118237459-118237481 TTTGGGAAGCAGGACAGGGAAGG + Intergenic
937039199 2:118807880-118807902 AGGGGGAAAGGGGAAAGGGAGGG + Intergenic
937150851 2:119684692-119684714 GGTGGGAAACAGGACAGGGTCGG - Intronic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
937788259 2:125928137-125928159 AGGGAAAAGAAGGAAAGGGAAGG - Intergenic
937969190 2:127536437-127536459 AGGGAGAGGCAGGACAGGTCTGG + Intronic
937986697 2:127641277-127641299 AGGGGGAGGCCAGACTGGGAGGG - Intronic
938046113 2:128122240-128122262 AGGGGGAAGTGGGCCAGGCATGG + Intronic
938163795 2:129009174-129009196 AGGGAGAGGCAGGCCAGGGACGG + Intergenic
938258331 2:129877711-129877733 AGGGCGAAGCAGGGAGGGGAGGG + Intergenic
938531774 2:132194665-132194687 AGGAGGAAGCAGGAGAAGGTGGG - Intronic
938716932 2:134029491-134029513 AGGGAGCAGCAGTACAGAGATGG + Intergenic
938836046 2:135105219-135105241 AGGGGGGAGCGGGAGGGGGAAGG - Intronic
939116626 2:138068836-138068858 AGGGGGCAGGAGAATAGGGAAGG - Intergenic
939187526 2:138878368-138878390 CTTGGGAAGCAGGACAGGGAAGG + Intergenic
939964024 2:148592947-148592969 TGGGGCAAGCAGGATGGGGAAGG + Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940412995 2:153388077-153388099 AGGTGGAAGCAGGTAGGGGAAGG + Intergenic
941708559 2:168686949-168686971 AGAGGGAAGCAGATCAGGGCTGG + Intronic
942151183 2:173076714-173076736 AGGGGGAAGCCCGAGAGGGCGGG - Intronic
942187009 2:173433665-173433687 AGGAGGAAGCAGGACAAAGAGGG - Intergenic
942482284 2:176402785-176402807 AGGAGGAAGGAGGGGAGGGAGGG - Intergenic
942482301 2:176402828-176402850 AGGGGGAAGTAAGAAAGGGAAGG - Intergenic
942482311 2:176402856-176402878 AGGGGGAAGGAAGAAAGGGAAGG - Intergenic
942482322 2:176402884-176402906 AGAGGGAAGGAAGAAAGGGAAGG - Intergenic
942671384 2:178379353-178379375 AGGGGAAGGAAGGAAAGGGAGGG + Intronic
943055149 2:182968214-182968236 ATAGGGAAGCATGACTGGGAAGG + Intronic
943330415 2:186552099-186552121 TAGGGGAAGCAGGATAGGGTGGG + Intergenic
943354811 2:186839878-186839900 AGGGGGAAGCAGCAAAGGGATGG - Intronic
944188693 2:196978266-196978288 AAGGGGGAGCAGGAGAGAGAGGG - Intronic
944199366 2:197089674-197089696 AGGGTGAAACATGGCAGGGATGG - Intronic
944490519 2:200253865-200253887 TGAGAGAAACAGGACAGGGATGG - Intergenic
944695572 2:202197439-202197461 AGGAGTAAGCAAGACAGAGAAGG + Intronic
944761782 2:202823218-202823240 AGGGGAGAACAGGTCAGGGAGGG - Intronic
945028653 2:205643258-205643280 AGTGGGAAGAAGGAGAGAGAGGG - Intergenic
945146019 2:206739123-206739145 AGTGGGAAGCAGGCCAGGCACGG + Intronic
945558655 2:211310677-211310699 AGGAGGAAGCAAGAGAGGGGAGG - Intergenic
945616626 2:212077632-212077654 GGGAGGAAGGAGGACAGGGATGG + Intronic
946419654 2:219557677-219557699 ACGGGGAGGCATGACGGGGAAGG + Intronic
946492224 2:220159950-220159972 AGGGGGAGGAGGGAAAGGGAAGG - Intergenic
947006039 2:225512571-225512593 AGGGGAAGGCAGGAAAGGAAAGG - Intronic
947078252 2:226367324-226367346 ACGGGGTTGCAGGACAGGGTAGG + Intergenic
947124161 2:226849932-226849954 ATAGGGAAGCAAGACAGGAATGG - Intronic
947219358 2:227777952-227777974 GGGAGGAAGGAAGACAGGGAGGG - Intergenic
947525435 2:230874382-230874404 AGGGGGACGCAGGCCATGGAGGG - Intronic
947557715 2:231111273-231111295 GAGGGGTAGCAGGACAAGGAAGG - Intronic
947715625 2:232337589-232337611 AGGGGGAAGGAGTACAGGCTGGG - Intronic
947841600 2:233211282-233211304 AAGGGGAGGCAAGGCAGGGATGG - Intronic
948251088 2:236529792-236529814 GCTGGGAAGCAGGACAGGGCCGG - Intergenic
948282707 2:236760243-236760265 AGGAGGAAGGAAGAAAGGGAAGG + Intergenic
948383442 2:237567119-237567141 AGGGGGAAGCAGGTCAGCCGGGG - Exonic
948507093 2:238435658-238435680 AGGCAGCCGCAGGACAGGGACGG - Intronic
948507434 2:238438712-238438734 AGGGGGAACTGGCACAGGGAAGG - Intronic
948577651 2:238965004-238965026 AGGGGGAAGCAGGAGGGAGGAGG - Intergenic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948681793 2:239640152-239640174 GAGGGGAAGCAGGGCAGGGGAGG + Intergenic
948691360 2:239706999-239707021 AGGGCAAAGCAGGGCAGGGCAGG - Intergenic
948691444 2:239707249-239707271 AGGGCAAAGCAGGGCAGGGCAGG - Intergenic
948691527 2:239707489-239707511 AGGGCAAAGCAGGGCAGGGCAGG - Intergenic
948720042 2:239893774-239893796 AGTGGGAAGCACGGCAGGGAAGG + Intronic
948722722 2:239911725-239911747 TGGGGGAAGGAAGAGAGGGAAGG - Intronic
948737990 2:240022678-240022700 GGGAGGAAGAAAGACAGGGATGG + Intronic
948908807 2:240992835-240992857 ATGGGGAAGGAAGGCAGGGAAGG - Intronic
948948848 2:241236041-241236063 TGGGGGAGACAGGGCAGGGAAGG - Intronic
949019884 2:241735038-241735060 AGGGGGCAGGAGGGCAGCGAAGG - Intronic
949047315 2:241877891-241877913 AGGGGGAAAGAGGAAGGGGAGGG - Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168960204 20:1863876-1863898 AGAGGGAAGTGAGACAGGGAAGG + Intergenic
1169122716 20:3107003-3107025 CGGGGGAAGCAGGGCAGGTGTGG + Intergenic
1169153241 20:3306962-3306984 AGGGATACCCAGGACAGGGAAGG - Intronic
1169178637 20:3542593-3542615 AGGGGGAAGGGGGAAGGGGAAGG - Intronic
1169198779 20:3697530-3697552 AGAGGGTTGCAGTACAGGGAAGG + Intronic
1169229196 20:3875795-3875817 TGGGGGAGGCAGGACGGAGATGG - Exonic
1169321430 20:4636099-4636121 TAGGGTCAGCAGGACAGGGAAGG + Intergenic
1169371372 20:5030743-5030765 ATGGGGAAGTGAGACAGGGAAGG - Intergenic
1169693489 20:8360039-8360061 TGGAGGAAGCAAGACATGGATGG + Intronic
1169902900 20:10571121-10571143 AGGGTGATGCAGGCCAGGCATGG - Intronic
1170021360 20:11840082-11840104 TGGAGCAAGCAGGACATGGAAGG - Intergenic
1170336743 20:15278463-15278485 AGTGAAAAGCAGGACTGGGAGGG - Intronic
1170391058 20:15874942-15874964 AGAGGAAAGCAGAAGAGGGAAGG + Intronic
1170540297 20:17380921-17380943 TCTGGGAGGCAGGACAGGGAGGG - Intronic
1170558825 20:17538162-17538184 AGGAGGAAGGAAGAAAGGGAAGG + Intronic
1170614104 20:17935231-17935253 ATGGGGATGAAGGAGAGGGATGG + Intergenic
1170743154 20:19075497-19075519 AGGGCAGAGCAGGACAGGGTAGG - Intergenic
1170749133 20:19129831-19129853 AGGGGCAAGCTGGATAGTGAGGG - Intergenic
1170773198 20:19352035-19352057 GGAGAGAAGCAGGACAGGGCAGG + Intronic
1170803099 20:19606689-19606711 AGAGGGAAGAAGGCCAGGGAAGG + Intronic
1170821861 20:19760825-19760847 TGGGGAAAGGAGGACAGGGTCGG - Intergenic
1170950268 20:20930453-20930475 TGGAGGAAGCGGGACAGGGAAGG - Intergenic
1170978725 20:21190970-21190992 AGGAGGGAGGTGGACAGGGAGGG + Intronic
1171012738 20:21517328-21517350 TGGGGGCAGCTGGGCAGGGAGGG + Intergenic
1171027428 20:21643721-21643743 AGGGGGAAGAAGGTGAGAGAAGG + Intergenic
1171049296 20:21840422-21840444 AAGGGGAAGAGAGACAGGGAAGG - Intergenic
1171088666 20:22263465-22263487 GTGGGGAAGAAGGGCAGGGAGGG - Intergenic
1171151839 20:22834596-22834618 GGAGGGAGGGAGGACAGGGAAGG - Intergenic
1171435279 20:25117401-25117423 AGGAGGGAGCAGGGCAGGGTTGG - Intergenic
1172629161 20:36366726-36366748 AGGAAGAAGCAAGACAGGGAAGG + Intronic
1172733469 20:37108414-37108436 AAGGGGAAACTGGACTGGGATGG + Intronic
1172785597 20:37466328-37466350 ATGGGGAAGCAGGACAGGAAAGG - Intergenic
1172805450 20:37608627-37608649 TGCGGGAGGCAGGACAGGAAAGG - Intergenic
1172808301 20:37629215-37629237 AGAGGGAAGCAGGAGAGGGAAGG + Intergenic
1172882026 20:38208309-38208331 AAAGGCAAGCAGAACAGGGAAGG - Intergenic
1172882119 20:38208876-38208898 AGAGGGAAGCAGGACTGGAAGGG + Intergenic
1172940289 20:38649380-38649402 AGAGTGAAGGAGGATAGGGAAGG + Intronic
1172943925 20:38673843-38673865 AGAGGGAATCAGGAAAGCGATGG + Intergenic
1173001780 20:39110271-39110293 AGGGGGAAGGAAGGAAGGGAGGG - Intergenic
1173179750 20:40796849-40796871 TGAGGGAAGGAGGGCAGGGAGGG - Intergenic
1173216853 20:41093415-41093437 AGGGGAAAGAAGAAGAGGGACGG - Intronic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1173566010 20:44039182-44039204 AGGATGGAGCAGGAGAGGGAAGG + Intronic
1173569480 20:44067249-44067271 TGAGGGAGGCAGGACAGGGTGGG + Intronic
1173624824 20:44465085-44465107 GAAGGGAAGCAAGACAGGGAGGG + Intronic
1173651040 20:44664401-44664423 AAGGGGAAGTATGACAGAGAGGG - Intergenic
1173660401 20:44729318-44729340 TGGGAGATGCAGGACAAGGAAGG + Intergenic
1173904180 20:46613803-46613825 AGGGGGAAGGAGGCCTGGGCTGG + Intronic
1173954064 20:47017140-47017162 AGGGGGCACCAGAACAGAGAAGG - Intronic
1173969643 20:47142267-47142289 AGGGAGAAGCACCTCAGGGAGGG + Intronic
1174121884 20:48271986-48272008 AGGGGAAAGCAGGGTAGGGCAGG - Intergenic
1174220256 20:48948805-48948827 GGCGGGAAGACGGACAGGGAGGG - Intronic
1174253195 20:49234706-49234728 AGGGGGAAGCAGCTAAGGGCTGG - Intronic
1174267316 20:49341142-49341164 AGGGGGGAGGGGGAGAGGGAAGG - Intergenic
1174283049 20:49453149-49453171 AGAGAGAAGCAGGACAGGATAGG + Intronic
1174327366 20:49790025-49790047 GGAGGGAAGTAGGACAGGGAAGG - Intergenic
1174367979 20:50067877-50067899 AGAGGGAAACAAGGCAGGGAGGG - Intergenic
1174707243 20:52669418-52669440 TGGGAGAAGCAGCCCAGGGAAGG + Intergenic
1174751788 20:53118447-53118469 TGAGGAAAGCAGGACAGGGCAGG + Intronic
1174769106 20:53281729-53281751 GTAGGGAAGCAGGACAGGGAAGG + Intronic
1175120082 20:56710588-56710610 AGGGGGAAGAAGGAGCGGTAGGG - Intergenic
1175295735 20:57907606-57907628 AGGGGGATTCAGGCCAGTGACGG - Intergenic
1175324096 20:58110550-58110572 GAGGGGAACCAGAACAGGGATGG - Intergenic
1175491924 20:59385168-59385190 AGGGGAAAGGAGGTAAGGGAGGG + Intergenic
1175531258 20:59675193-59675215 AAGAGGGAGAAGGACAGGGAGGG - Intronic
1175633414 20:60560703-60560725 AGGGGCCGGCAGGGCAGGGAGGG + Intergenic
1175824675 20:61930498-61930520 AGTGGGAGGCAGGGCGGGGAAGG + Intronic
1175863893 20:62164296-62164318 AGGGGCAAGGAGGGCAAGGAGGG + Intronic
1175871842 20:62212917-62212939 TGGGGGAAGGAGAGCAGGGATGG + Intergenic
1175948305 20:62568976-62568998 AGGGGTAGGGAGGAGAGGGAGGG - Intronic
1175985903 20:62764051-62764073 AGGTGGCAGCAGGGCTGGGAGGG + Intergenic
1175989235 20:62779267-62779289 AGAGGGCAGCATGGCAGGGAGGG - Intergenic
1176034489 20:63029551-63029573 GGCAGGACGCAGGACAGGGAAGG - Intergenic
1176231648 20:64036110-64036132 GGGAGGGAGCAGGAGAGGGAAGG - Intronic
1176269309 20:64227388-64227410 AGAGGGAAGCAGAACTGGAACGG - Intronic
1176301707 21:5101768-5101790 GGGCAGAGGCAGGACAGGGACGG + Intergenic
1176415897 21:6474632-6474654 CGGGGGCAGCAGGACAGGCCTGG - Intergenic
1177610518 21:23441857-23441879 AGTGGGAAGTAGCAGAGGGAAGG - Intergenic
1177849889 21:26333507-26333529 AGGGGGAAAGAAGAGAGGGAAGG + Intergenic
1178349870 21:31864979-31865001 AAGGGGAAACAAGGCAGGGAGGG - Intergenic
1178606126 21:34037526-34037548 AGTGGGAGGCAGGAAAAGGATGG - Intergenic
1179123012 21:38566324-38566346 TGGGGGAAGCAGGAATTGGAGGG - Intronic
1179217123 21:39377228-39377250 AGAGGGAAGCAGGAGAGCCAGGG + Intergenic
1179250006 21:39664543-39664565 ACGGGGAAGGGGGTCAGGGAAGG - Exonic
1179250012 21:39664556-39664578 ATGGGGCAGCGGGACGGGGAAGG - Exonic
1179364985 21:40750712-40750734 TGAGGGAAACAGGGCAGGGAAGG - Intronic
1179375271 21:40845117-40845139 AGGAGGACACAGGACAGGTATGG + Intronic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179660435 21:42871185-42871207 AGGGGCTGGCAGGACAGGGCTGG - Intronic
1179691397 21:43082966-43082988 CGGGGGCAGCAGGACAGGCCTGG - Intergenic
1179716883 21:43293026-43293048 TGGAGGAGGGAGGACAGGGAGGG - Intergenic
1179716903 21:43293076-43293098 TGGAGGAGGGAGGACAGGGAGGG - Intergenic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1179855324 21:44160131-44160153 GGGCAGAGGCAGGACAGGGACGG - Intergenic
1179908221 21:44435069-44435091 ATGGGGGAGCAGGACAGGGCAGG - Intronic
1180129257 21:45816463-45816485 AGGGGGAGGAGGGAGAGGGAGGG - Intronic
1180186810 21:46144423-46144445 AGGGGGAAAGAGGGGAGGGAGGG - Intronic
1180234357 21:46448463-46448485 AGAGGTGAGCAGGACAGGTATGG + Intergenic
1180261681 21:46674642-46674664 AGGGAGGAGGAGGAAAGGGAGGG + Intergenic
1180429265 22:15231220-15231242 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1180714024 22:17859292-17859314 AGGGGGACGGAGGCCAGAGAGGG + Intronic
1181014725 22:20062378-20062400 GGGGGCAAGCTGGACAGGGTGGG - Intronic
1181035901 22:20169609-20169631 GGGGGGCAGCAGCCCAGGGATGG + Intergenic
1181182893 22:21079651-21079673 AGAGGGAAGCTGGCCAGGGCTGG + Intergenic
1181387741 22:22557958-22557980 TGGGGGAAGGAAGACAGGGTGGG + Intronic
1181387757 22:22557994-22558016 TGGGGGAAGGAAGACAGGGTGGG + Intronic
1181909662 22:26228575-26228597 AGGAGGAAGCAGAACTGGGAAGG - Intronic
1182307726 22:29382598-29382620 GGAGGGAAGGAGGATAGGGAGGG + Intronic
1182524599 22:30907450-30907472 AGGGGGCATGAGGAGAGGGAAGG - Exonic
1182735743 22:32531341-32531363 AGGGGGAGAGAGGACAGGCAGGG - Intronic
1182994276 22:34798565-34798587 CGAGGGAAGCAGGACAAGGTAGG + Intergenic
1183010537 22:34943138-34943160 AGGGGGAAGCAGAACTGGCAGGG + Intergenic
1183153088 22:36053514-36053536 AGGGAGAAGCAGGGAAGGGAAGG - Intergenic
1183179545 22:36250468-36250490 AGGGGGGAACAGAACAGGGCAGG - Intergenic
1183301326 22:37060530-37060552 GGGATGAAGCAGAACAGGGAGGG - Intronic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183346039 22:37308967-37308989 AGAGGGAAGCATGACCGGGGTGG + Intronic
1183413800 22:37671374-37671396 ATGGGGGAGCAGGTCAGGCACGG + Intergenic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183619321 22:38963541-38963563 CGGGGGAAGGAGCCCAGGGAGGG + Intronic
1183624468 22:38993136-38993158 CGGGGGAAGGAGCCCAGGGAGGG + Intergenic
1183730468 22:39615632-39615654 AGGAGGACACAGGACAAGGATGG - Intronic
1183732750 22:39627848-39627870 ATGGGGAAGGAAGAGAGGGAAGG + Intronic
1183960722 22:41410407-41410429 TGTGGGAAGCAGGGCAGGTAGGG + Intergenic
1184091311 22:42294427-42294449 AGCGGGAGGGAGGCCAGGGAAGG + Intronic
1184117599 22:42431327-42431349 GGGGTGCAGCAGGACAGGGTGGG + Intronic
1184147390 22:42619497-42619519 AGGGGTCATGAGGACAGGGATGG + Exonic
1184339657 22:43879293-43879315 CGGGGGGAGCAGGGCAGGCAGGG - Intergenic
1184688400 22:46106640-46106662 TTGGGGAAGCCAGACAGGGAGGG + Intronic
1184789257 22:46689232-46689254 AGGAGGCAGCAGGGCTGGGAAGG - Intronic
1185019449 22:48365620-48365642 AGGAGGCAGCAGGGCAGGCACGG + Intergenic
1185229817 22:49673573-49673595 AGGGGGAGGGAGGACAGAGGGGG + Intergenic
949295321 3:2514917-2514939 AGGGGGTAGCAGAAGATGGAGGG - Intronic
949414330 3:3799638-3799660 AGGGGGAGGCAGGACTGGGAAGG - Exonic
949493523 3:4610954-4610976 AGGGGGAAGGGGGAAGGGGAAGG - Intronic
949792856 3:7812155-7812177 ACGGGGTAGCGGGAAAGGGAAGG + Intergenic
949961803 3:9318419-9318441 AGGGGGAAGGAGGAAAGAGGAGG - Intronic
950165955 3:10799128-10799150 AGGGCGAGGCAGGTCAGGGCAGG - Intergenic
950399819 3:12761218-12761240 AGGAGGAAGCAAGAGAGGCAGGG + Intronic
950525909 3:13523174-13523196 AGGGGGAAGCTGGGCGGGGCTGG - Intergenic
950528926 3:13541201-13541223 AAGGGGAAGAAGGACTGGGCAGG + Intergenic
950607375 3:14094697-14094719 AGGGGAAAGCAAGGAAGGGAGGG + Intergenic
950614834 3:14150181-14150203 AGAGGGGCGCAGGACAGGCAAGG + Intronic
950648218 3:14391028-14391050 AGAGGGAAGGTGGGCAGGGATGG - Intergenic
950833475 3:15897977-15897999 TGGGGGAAGGAAGACAGGGAAGG - Intergenic
950883655 3:16344480-16344502 AGGGGGAAGAAGGCCAGGGCAGG - Intronic
951217821 3:20040840-20040862 AGGTGGAAGCGGGAGGGGGAGGG - Intronic
951454819 3:22878623-22878645 TTGGGGAAGCAGGGCAGGGAAGG - Intergenic
952046809 3:29331478-29331500 ATGGGGAAACAAGACAGAGAAGG - Intronic
952128547 3:30332585-30332607 GGGGGACAACAGGACAGGGAAGG + Intergenic
952354801 3:32574222-32574244 AGGGGGCAGAAAGAAAGGGATGG - Intergenic
952648282 3:35689219-35689241 AGGGGGAAACAGGATAGGTTGGG + Intronic
952820704 3:37483491-37483513 AGGGGGAAGTAAGAATGGGAAGG + Intronic
952861934 3:37820150-37820172 TGGGGGAAGCAGGACAAGGAAGG + Exonic
953190981 3:40687967-40687989 ATGGGAAAGAAAGACAGGGAAGG + Intergenic
953197189 3:40745691-40745713 ATGGAGAAGCAAGACTGGGAAGG - Intergenic
953226987 3:41030128-41030150 AGAAGGAAGCAGGACAAAGACGG + Intergenic
953261079 3:41339498-41339520 TGGGAGAAGCAGGAGAGGGGAGG - Intronic
953571220 3:44073260-44073282 AGGGGGGAGTGAGACAGGGAAGG + Intergenic
953707950 3:45245397-45245419 TGGGGAAAGCAGGACCAGGAAGG + Intergenic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
953920458 3:46947973-46947995 AGGGAGAATCAGGCCAGGGCAGG + Intronic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954368353 3:50157576-50157598 AAGGAGAAGAAGGACAGAGAGGG - Intronic
954368357 3:50157604-50157626 GGGGGAAAGAAGGAGAGGGAAGG - Intronic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
954628312 3:52034894-52034916 AGGTGGAGGATGGACAGGGAAGG + Intergenic
954692334 3:52402210-52402232 AAGGGGAAGTGGGGCAGGGAAGG + Exonic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955716791 3:61837920-61837942 AGGAAGAAGAAAGACAGGGAAGG - Intronic
955984268 3:64556756-64556778 AGGAGGAAGGAAGAAAGGGAGGG - Intronic
956469815 3:69554868-69554890 TGGGGTAAGTAGGACAGGAAGGG + Intergenic
956606333 3:71076490-71076512 ATGGGCAGGCAGGACCGGGAAGG + Intronic
956728013 3:72172414-72172436 AGGGAGAAGGAGGAGAGGGGAGG + Intergenic
956778717 3:72587721-72587743 AGAGGGAAGCAGGACTGGGAGGG + Intergenic
956791496 3:72683518-72683540 TGGGGGGAGCAGGACAGGGAAGG + Intergenic
956849697 3:73217711-73217733 AGGGGGAAGAGGGAAGGGGAGGG - Intergenic
956927588 3:74005717-74005739 AGAGGGAAGCAAGACAGTCAAGG + Intergenic
957185658 3:76938411-76938433 AGAGGGAAGCAGGCCAGTGTAGG - Intronic
957436463 3:80183219-80183241 TGGAGGAGGCAGGATAGGGAAGG - Intergenic
957867982 3:86049702-86049724 AGGGGGAAGGAGGAAGGTGAGGG + Intronic
958040218 3:88218561-88218583 TGGAGGAAGCAGGACAAAGAAGG + Intergenic
958518929 3:95158866-95158888 AGGGGGTAGGAGGATAGGGGAGG - Intergenic
958536606 3:95412002-95412024 AGGAGGAAGAAGGAAAAGGAAGG - Intergenic
958734582 3:97993806-97993828 AGGGGAAAAAAGGAAAGGGAAGG - Intronic
958766269 3:98372072-98372094 AGGAGGAAAAAGGAAAGGGAGGG + Intergenic
959301242 3:104604739-104604761 AGGGGGAAACATGTCAGGAAAGG + Intergenic
959388886 3:105748439-105748461 TGGGGGTAGCAGGATAAGGACGG - Intronic
959398198 3:105868397-105868419 AGGAGGAAGGTGGACTGGGAGGG + Intronic
959758209 3:109925001-109925023 AGGGGGGAACAGGCCAGGCATGG - Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960822895 3:121753003-121753025 AGGGGAAAGAAGAAGAGGGATGG + Intergenic
960950123 3:122993775-122993797 TGGGGGAGGCAGGAGCGGGAGGG - Intronic
960987021 3:123287371-123287393 AGGGAGAAGCAGCTCAGCGAAGG - Intronic
961005951 3:123405494-123405516 AGGAGGGAGCAGGACAGGAGGGG + Intronic
961075387 3:123977391-123977413 AGGGGAAGGCAGCACAGGAATGG + Intronic
961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG + Intronic
961308297 3:125975131-125975153 AGGGGAAGGCAGCACAGGAATGG - Intronic
961369888 3:126422776-126422798 TGGGGGAGGCAGGGCAGGAAAGG + Intronic
961416573 3:126763271-126763293 AGGGAGAAGAGGGAAAGGGAGGG - Intronic
961444249 3:126971812-126971834 AGGGGGCAGCAGGGCAGCGAAGG - Intergenic
961667977 3:128505457-128505479 ATTGGGAAGCAAGACAGAGATGG + Intergenic
961673236 3:128549636-128549658 TGGGGGCAGAAGGCCAGGGAAGG + Intergenic
961734558 3:128993423-128993445 CGGGGGAAGCAGGGAAGAGAAGG - Intronic
962064007 3:131960123-131960145 AGAGGGAGGGAGGAGAGGGAGGG + Intronic
962072199 3:132044669-132044691 AGGGGGAGGGAGGGGAGGGAGGG + Intronic
962204846 3:133425976-133425998 AGGGGAAGGCAGGGCAGGGCAGG + Intronic
962273950 3:133998387-133998409 AGGGGGAGGCAGGACATGGGCGG - Intronic
962311336 3:134329148-134329170 AGGGGAAGGGAGGAAAGGGAGGG - Intergenic
962346297 3:134621018-134621040 TGGGGGAAGTTGGACAGGGCAGG + Intronic
962372034 3:134828714-134828736 AGGAGGCTGCAGGCCAGGGAAGG + Intronic
962420636 3:135225832-135225854 AGGCCCAAGCAGGACAGGCAGGG + Intronic
962613811 3:137104228-137104250 AGGGGAAGGTAGAACAGGGATGG + Intergenic
963052275 3:141152314-141152336 AGGGGGAAGAAGGGCTGGGAGGG - Intergenic
963322187 3:143821008-143821030 CTGGGGAAGCTGGACTGGGAAGG + Intronic
963919514 3:150892316-150892338 TGAGGGAAGCAGGACAGGGAAGG - Intronic
964374432 3:156035591-156035613 AGGAGGAAGCAGGAGGGGGGAGG - Intergenic
965242773 3:166225118-166225140 AGTGGGAAATAGGACTGGGAAGG + Intergenic
965597870 3:170425661-170425683 TGGGGGAAGCAGGACATGGAGGG + Intronic
965641484 3:170833357-170833379 AGGAGGAAGGAAGAAAGGGAGGG + Intronic
965719103 3:171641683-171641705 ATGTGGAAGCAGGAGAGGAAGGG - Intronic
966750578 3:183317788-183317810 GGTGGGAAGCAGCACAGGGAAGG - Intronic
967014566 3:185470033-185470055 AGGGGTAGGAAGGACAAGGAGGG + Intronic
967109464 3:186280826-186280848 AGTGGGAAGAGGGACAGGGCAGG + Intronic
967277388 3:187789929-187789951 AGGGGGAGGGAGGGGAGGGAGGG + Intergenic
967391607 3:188961708-188961730 AGGAGGAAACAGAACAAGGAAGG - Intronic
967841056 3:194004710-194004732 AGTGGGAAGCAGGGCCGGGAAGG + Intergenic
968294767 3:197567477-197567499 AGGCAAAAGCAGGACAGGGAGGG - Intronic
968461828 4:730071-730093 AGTGGGGATGAGGACAGGGAGGG - Intronic
968616138 4:1578743-1578765 AGGGGAGGGCAGGGCAGGGAAGG + Intergenic
968689704 4:1984202-1984224 AGAGGGTAGCAGGACAGAGAAGG - Intronic
968737134 4:2303458-2303480 AGAGAGACGGAGGACAGGGAGGG - Intronic
968857496 4:3138119-3138141 AGAGGGAAGTAGGGAAGGGAGGG - Intronic
968878741 4:3287977-3287999 GCTGGGAAGCAGGGCAGGGATGG - Intergenic
968901065 4:3432065-3432087 AGGGGGACTCAGGCCAGGGGTGG - Intronic
968914757 4:3492535-3492557 AGGTGGCAGAAGGACAGGAACGG + Intronic
968951176 4:3693095-3693117 TGGGGGAGGACGGACAGGGAAGG - Intergenic
969075365 4:4574050-4574072 TGGAGGAAGCAGGAGAGGAAAGG - Intergenic
969312892 4:6364350-6364372 AGGAGGAAGTGGGCCAGGGAGGG + Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969573848 4:8025270-8025292 CGGGGGAACCAGGGCAGAGATGG + Intronic
969579395 4:8055351-8055373 AGGGGGCAGCAGGTCAGGCTGGG - Intronic
969586466 4:8097015-8097037 AGGAGGAAGAAGGGAAGGGAGGG + Intronic
969614529 4:8244631-8244653 TGGAGGAACCAGTACAGGGAAGG - Intergenic
969943893 4:10762877-10762899 AGGGGGCAGCAGGCCAGAGATGG + Intergenic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970228826 4:13887919-13887941 AGGGAGAAGGAGGAAATGGATGG - Intergenic
970313663 4:14808998-14809020 AGAAGGAAGCAGGACTGGGCAGG - Intergenic
970483378 4:16500270-16500292 TGGGAAAAGCAGGATAGGGAAGG - Intergenic
970751885 4:19373199-19373221 AGAGAGAAACATGACAGGGAGGG + Intergenic
971268705 4:25117309-25117331 GAGGGGAAGCAGGCCAGGGCAGG + Intergenic
971325326 4:25638730-25638752 AGGGGGAAGCAGGCCAGGTGCGG + Intergenic
971562982 4:28105243-28105265 AGGTGAAAGCAGGACAAGGTAGG + Intergenic
971582296 4:28357280-28357302 ATGGGAAAGGAGGAGAGGGAAGG + Intergenic
972019398 4:34291119-34291141 AGGAGGAAGAAAGAGAGGGAAGG + Intergenic
972833152 4:42837007-42837029 GAGGAGAAGCAGGGCAGGGAAGG + Intergenic
972872668 4:43319736-43319758 AGGGAAAAGCAGGACAGGGCAGG - Intergenic
973151147 4:46889515-46889537 ACGGGGAAGCAAGATAGGCAAGG + Intronic
973554473 4:52068538-52068560 AGGAGGAAGCAGGTGGGGGATGG + Intronic
973741788 4:53925748-53925770 GTGAGGCAGCAGGACAGGGAAGG - Intronic
973858421 4:55036432-55036454 TGAGGGAAGCAAGACAGGGCTGG + Intergenic
974861411 4:67526167-67526189 GGGGGGAGGGAGGAAAGGGAAGG + Intronic
974880938 4:67756417-67756439 ATGGGGTATGAGGACAGGGAGGG + Intergenic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975574539 4:75849691-75849713 AGGAGGAAGCAGTCAAGGGAAGG + Intergenic
976266164 4:83186986-83187008 AGAGGGGAGAAGGAGAGGGAGGG + Intergenic
976579711 4:86721719-86721741 AGGGGGAAGGGGGAAGGGGAGGG - Intronic
977271587 4:94923755-94923777 AGGGGCAAACAGGGCAGAGAAGG - Intronic
977990974 4:103442291-103442313 AGGGGGAAGGAGGGAAGGGAGGG - Intergenic
978380078 4:108117716-108117738 AGGGGGAGGAAGAGCAGGGAGGG + Intronic
978744927 4:112182118-112182140 ATGGGGAAGAGGGAGAGGGAGGG + Intronic
978833361 4:113116495-113116517 AGGGGTGAGCAGGTCTGGGAAGG - Intronic
979169522 4:117583341-117583363 AAGTGGAAGTAGGACAGAGAGGG - Intergenic
979291149 4:118980439-118980461 AGGAGGATGCAGGCCAAGGAAGG - Intronic
979788623 4:124750019-124750041 GGAGGGAATCAGGAAAGGGAAGG + Intergenic
979944270 4:126806879-126806901 AGGGAGAAGCAGAACAGATAAGG + Intergenic
980495447 4:133584366-133584388 AGTGGGAAGGAGGACTGGAAAGG - Intergenic
980890733 4:138812249-138812271 TGTGGGGAGCAGGAGAGGGATGG + Intergenic
980929901 4:139176080-139176102 GCGCGGAAGGAGGACAGGGAGGG - Intronic
980987612 4:139710954-139710976 TGGGGGTAACAGGACAGAGAAGG + Intronic
981756494 4:148145905-148145927 AGGTGGAAGAAGGAGAGAGAAGG + Intronic
983263724 4:165485932-165485954 TGAGGGAAGCAGGGCAAGGAAGG + Intronic
983437591 4:167734622-167734644 GGAGGGAGGCATGACAGGGAAGG - Intergenic
983899904 4:173122683-173122705 AGGTGGAACCAGGTCAGGAATGG + Intergenic
983904711 4:173170116-173170138 GGGGGGAAGCAGGTCAGGGTCGG - Intronic
983919718 4:173333480-173333502 AAGGTGAGGCAGGAGAGGGACGG - Exonic
984222452 4:176994695-176994717 AGGGGGAAGGGGAAGAGGGAGGG - Intergenic
984593728 4:181644305-181644327 AGGAGGGAGGCGGACAGGGAGGG + Intergenic
984714865 4:182916759-182916781 AGGGAAGAGCAGGAGAGGGAAGG + Intronic
985189805 4:187360391-187360413 AGGAGGGAGGAAGACAGGGAAGG + Intergenic
985336967 4:188906151-188906173 AGGAGGAAGGAGGAAAGGAAGGG - Intergenic
985378774 4:189370736-189370758 ACGGGGAGGCAGGAAAGGAAAGG + Intergenic
985393022 4:189511952-189511974 TGGGTGAAGTAGGACACGGAAGG - Intergenic
985652305 5:1112624-1112646 AGGGGGAAGAAGGAGGGGTAGGG - Intergenic
985713180 5:1441814-1441836 GGGGGGACGCAGGCCAGGGAAGG - Intronic
985875584 5:2591557-2591579 AGGGGAAAGGAGGAAAAGGAAGG + Intergenic
985879194 5:2625633-2625655 TGGAGGGAGCAGGACAGGGAAGG - Intergenic
985901691 5:2800812-2800834 ATGTGGAGGAAGGACAGGGAAGG - Intergenic
985957151 5:3274384-3274406 AGGGTGAGGCAGGGCAGGGATGG - Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986183629 5:5416977-5416999 GAGGGGAAGGAGGACGGGGAGGG + Intergenic
986240355 5:5954899-5954921 AGGGGAAAGAAGGAGAAGGAGGG - Intergenic
986500455 5:8393243-8393265 AGTAGGAAGCAAGAAAGGGAGGG + Intergenic
987282996 5:16429323-16429345 AGGGGGAAAGAGGCCAGGCATGG + Intergenic
987452943 5:18108424-18108446 AGTGGTAAGCAAGACAGGCAGGG - Intergenic
988535758 5:32066378-32066400 AGGTGGAAGCAGGACTTGGTTGG - Intronic
989277912 5:39610721-39610743 AGGGGAAAGCAGGGAAGGCAGGG - Intergenic
989589797 5:43102777-43102799 TGGTGGAAGCAGGAAAGGAAAGG - Intronic
989774020 5:45181118-45181140 AGACATAAGCAGGACAGGGAGGG - Intergenic
990290334 5:54344183-54344205 TGAGGGAAGCAGGACAGGACAGG + Intergenic
990346173 5:54873877-54873899 TGAGGGAAGCAGGATAGGGCAGG - Intergenic
990493827 5:56326978-56327000 ACTGGGAGACAGGACAGGGAGGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990526607 5:56634318-56634340 AGAAGGAAGCAGGTCAGGGCAGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
990942106 5:61213174-61213196 TGAGAGAAGCAGGATAGGGAAGG + Intergenic
991084929 5:62639985-62640007 AGAGGGTAGGAGGAGAGGGATGG - Intergenic
991411600 5:66351644-66351666 AGGGGGAAGCAGTCAAAGGAGGG - Intergenic
991501515 5:67281986-67282008 AGGGGGAAGGAGGAAGGGAAGGG - Intergenic
991960451 5:72039094-72039116 AGGGGGAGGCAGGCCAGGTAGGG - Intergenic
992184655 5:74232386-74232408 AGAGAGAGGGAGGACAGGGATGG - Intergenic
992272830 5:75083431-75083453 AGGGGAAAGCAGGCCAGGCCAGG + Intronic
992662497 5:78975199-78975221 AGGAGCAGGCAGGACAGTGAGGG + Intronic
992887349 5:81171771-81171793 TGGGGCAAGAAGGAAAGGGATGG - Intronic
993038346 5:82783489-82783511 GTGGGGAAGCAGGATAGGAAAGG + Intergenic
993315213 5:86395475-86395497 AGGAGGAAGCAGAAGAGGAAGGG + Intergenic
993330155 5:86589608-86589630 GGAGGCAAGCAGGACAGGGAAGG - Intergenic
994130323 5:96219719-96219741 AGGAGAAAGCAAGAAAGGGAAGG + Intergenic
994185225 5:96808320-96808342 AGGGGCATGCAGGAAAGGGCCGG + Intergenic
994637106 5:102357034-102357056 AGGGGGAAGCATGGGAGGGAGGG + Intergenic
995183362 5:109249020-109249042 TGAGGGAAGCAGGACAGTGCAGG + Intergenic
995209571 5:109521897-109521919 AGGGGGAAGAAAGAAGGGGAAGG - Intergenic
995482983 5:112611162-112611184 CGAGGGAAACAGGATAGGGAAGG + Intergenic
995895148 5:117002902-117002924 AGGGGGGAGAGGGAGAGGGAGGG + Intergenic
996308668 5:122078415-122078437 TGGGGGGAGGAGGGCAGGGACGG - Intergenic
996518622 5:124401361-124401383 ATGGGGAAGGAGGACAGAGTAGG - Intergenic
996651224 5:125879492-125879514 AGGGGAAAGGAGGAAAGAGAAGG - Intergenic
997267276 5:132502198-132502220 AGGGTCATGCAGGGCAGGGAAGG - Intergenic
997929896 5:138063972-138063994 AGTGGATAGCAGGACAGGCACGG + Intergenic
998004615 5:138648797-138648819 AGAGGCAGGCGGGACAGGGAAGG + Intronic
998114531 5:139526096-139526118 AGAGAGAAGCAGAACAGGGCAGG - Intergenic
998171501 5:139874514-139874536 AGGAGGTAGCAAGACATGGATGG - Intronic
998184588 5:139968574-139968596 AGGAGGAAGGAGGGCTGGGAAGG + Intronic
998384448 5:141748434-141748456 AGGGAGGAGCAGGGGAGGGAAGG - Intergenic
998399544 5:141841410-141841432 AGGGGGAAGGAGGGAAGAGAAGG + Intergenic
998401989 5:141852983-141853005 GGGGGGCAGCTGGACAGGGGTGG - Intergenic
998450599 5:142231726-142231748 AGAGGGCAGAAGGAAAGGGAGGG - Intergenic
999019232 5:148144742-148144764 ATGGGGAAGTAGGTCATGGAAGG - Intergenic
999475888 5:151898615-151898637 AGGGGGAGGAAAGACAAGGAGGG + Intronic
999666982 5:153922821-153922843 AGAGGGAAGCAGGAGAGGCTGGG - Intergenic
1000147591 5:158468363-158468385 AGGGGGAAGTAAGGCAGGAAGGG - Intergenic
1000148075 5:158472696-158472718 AGGGAAAAGAAGGACAGGGGAGG - Intergenic
1000185058 5:158851356-158851378 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1000217462 5:159175595-159175617 ATGGGGAAGCAGGGCAGGAAGGG - Intronic
1000351586 5:160356869-160356891 AGGGGGCAGGAGGAGAGGTATGG - Intronic
1000360982 5:160447343-160447365 GGGAGGAAGAAAGACAGGGAAGG - Intergenic
1000882452 5:166713917-166713939 AAGAGGAAGCAGGAAAGAGAGGG + Intergenic
1001276690 5:170356409-170356431 AGGAACAGGCAGGACAGGGAGGG - Intronic
1001397021 5:171424845-171424867 AGGGGGAAGGGGGAGGGGGAGGG + Intronic
1001437715 5:171713423-171713445 AGGGGGAAAGAGCACAGGGAAGG - Intergenic
1001491159 5:172156441-172156463 AGGGGGAGGCACCACAGGAAAGG + Intronic
1001663400 5:173413196-173413218 AATGGGAAGCAGCACAGGGCAGG + Intergenic
1001881455 5:175247990-175248012 TGGGAGACGAAGGACAGGGAAGG + Intergenic
1001946165 5:175779904-175779926 AGGAGGAAGCAAGAGAGAGAGGG - Intergenic
1001977908 5:176015454-176015476 AGAGGGAGGAAGGATAGGGAAGG - Intronic
1002057868 5:176609229-176609251 AGGGGTGAGCAGGCCAGGGCAGG + Intronic
1002060181 5:176621188-176621210 AGGGGGCAGCAGGGCTGGGCGGG - Intronic
1002239512 5:177828308-177828330 AGAGGGAGGAAGGATAGGGAAGG + Intergenic
1002257469 5:177968760-177968782 AGGGGAAACCAGCACAGGCAAGG + Intergenic
1002401144 5:178992147-178992169 AGGGGGGCCCAGGACACGGACGG + Intronic
1002434695 5:179224027-179224049 AGGTGGAGACAGGACAGGGTAGG + Intronic
1002500862 5:179646818-179646840 AGGGGAGAGGAGGAAAGGGACGG - Intergenic
1002505910 5:179678995-179679017 AGGTAGAAGGTGGACAGGGAGGG + Exonic
1002607237 5:180390561-180390583 GGGGGCAGGCAGGCCAGGGATGG - Intergenic
1002825418 6:768314-768336 TGGGGGAAGACGGAGAGGGAGGG - Intergenic
1002851764 6:1003171-1003193 AGGGGGAGAGAAGACAGGGAAGG - Intergenic
1003080528 6:3017532-3017554 CTGGGGAAGCAGGCCTGGGAGGG - Intronic
1003162929 6:3651343-3651365 AGGAGGGAGGAAGACAGGGAGGG + Intergenic
1003179597 6:3780465-3780487 AGTGGGGAGCAGGCCGGGGAAGG + Intergenic
1003257250 6:4485290-4485312 GTGGGGCAGGAGGACAGGGAAGG - Intergenic
1003381916 6:5632564-5632586 AGGGGGAAGGAGGAAGGGAAAGG - Intronic
1003480300 6:6525110-6525132 AGCGGGGAGCAGGGCTGGGAAGG + Intergenic
1003521956 6:6865699-6865721 AGAGGGGACCAGCACAGGGAAGG + Intergenic
1003619988 6:7691328-7691350 AGGGGAAGGGAGGAGAGGGAAGG - Intergenic
1003809903 6:9767990-9768012 TGGGGGAAGCCAGAAAGGGATGG + Intronic
1003944649 6:11063773-11063795 AGTGGGTAGCTGGACTGGGATGG - Intergenic
1004002057 6:11604834-11604856 AGGGGGAAGGAGGAGGGGGGAGG + Intergenic
1004131258 6:12921817-12921839 AGGGGGAAGGAAGGAAGGGAGGG + Intronic
1004401703 6:15294645-15294667 AGGTTGATGCAGGACATGGAAGG + Intronic
1005914755 6:30342411-30342433 AGGGGGAGGTAGGACTGGGCTGG + Exonic
1006146622 6:31963379-31963401 AGAGGGAAGCAGGTCAGGGGTGG - Intronic
1006342204 6:33452908-33452930 TGGGGGAGGTAGGACAGGGCTGG + Exonic
1006610377 6:35291102-35291124 AGAGGGAAGCAGGGCAGAGTGGG + Intronic
1006715497 6:36116762-36116784 AGGGGGAAGGAGGTGAAGGAAGG - Intergenic
1006727423 6:36210061-36210083 AGGGGTCAGCAGGCCAGGGTGGG + Intronic
1006889948 6:37418178-37418200 AGGGGGACGGAGGAATGGGAAGG + Intergenic
1006933499 6:37701563-37701585 TGGGGGAAGGATGACTGGGAGGG + Intergenic
1006988757 6:38194844-38194866 ATGGGGAGGCAGGAGAGGCAGGG + Intronic
1007054806 6:38872005-38872027 AGAGGAAAGCAGGACAGGAATGG - Intronic
1007284308 6:40736665-40736687 AGGAGGTTGGAGGACAGGGAGGG + Intergenic
1007362243 6:41367308-41367330 GAGGGGAAGCAAGACAAGGAGGG - Intergenic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1008034798 6:46734892-46734914 GGGGAGAATCAGGACAGGCAGGG - Intronic
1008293455 6:49748088-49748110 AGAGTGAAGCAGGTCAGGGGAGG + Intergenic
1008592535 6:53008855-53008877 AGGGGAAAGCAGCACATGGCAGG + Intronic
1008883613 6:56408700-56408722 GGGGGGATGTAGGAGAGGGAGGG - Intergenic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1010016654 6:71111872-71111894 AAGGGGAAGCATGTCAGGGTCGG - Intergenic
1010029701 6:71260108-71260130 AAGGGTAAGCAGGATAGGGCAGG - Intergenic
1010243682 6:73642279-73642301 AGGGGGAGGCAGGGCCGGGGGGG - Intronic
1010265578 6:73862245-73862267 AAGGAGAAGCAGGAAAGGTAGGG - Intergenic
1010329292 6:74603508-74603530 AGGCGAGAGCAGGACTGGGAGGG + Intergenic
1010635577 6:78255818-78255840 TGAGGGAAGCAGGAAAAGGAAGG - Intergenic
1010656143 6:78514134-78514156 ATGGGACAGCAGGAGAGGGAAGG - Intergenic
1011017774 6:82777680-82777702 AGAGGGAAGGAGGGGAGGGAGGG + Intergenic
1011155239 6:84323097-84323119 AGTGTGCAGCAGGAGAGGGAAGG - Intergenic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1013289694 6:108709292-108709314 TGGGGGAAGCAGCACAGAGAAGG - Intergenic
1013523333 6:110952646-110952668 AGGGAGGAGAAGGAGAGGGAGGG - Intergenic
1013562946 6:111324696-111324718 AGGGGGAGGCGGAAGAGGGAAGG + Intronic
1013878298 6:114861884-114861906 GTGGGGAAGCAGAGCAGGGAAGG + Intergenic
1014270078 6:119326673-119326695 AAGGTGAAGCAAGGCAGGGAAGG + Intronic
1014453627 6:121611469-121611491 AGGGGGAAGCAGGAGAAGAGGGG - Intergenic
1014648368 6:124004449-124004471 AGAGGGAAGCCAGACAGGAAAGG + Intronic
1014987442 6:128029198-128029220 AGAGGGAGACAGGAGAGGGAAGG - Intronic
1015792950 6:136982307-136982329 GTGGGGAGGTAGGACAGGGAAGG + Intergenic
1015846103 6:137522621-137522643 AGGGGGAAGGAAGGAAGGGAGGG - Intergenic
1015901187 6:138069507-138069529 CCGGGGAAGCAGGACATAGATGG - Intergenic
1016062529 6:139645588-139645610 TGAGGGAAGCAAGACAGGGAAGG + Intergenic
1016267207 6:142246564-142246586 AGGGGCCACCAGGACAGGGGAGG - Intergenic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1016647251 6:146424388-146424410 AGTGGGAGGCTGGACAGGGCTGG + Intronic
1016763530 6:147767267-147767289 AGAAGGAAGCAGGATAGGGCAGG + Intergenic
1017295598 6:152790092-152790114 AAGGGCATGCAGGACAGGAAAGG - Intergenic
1017669996 6:156761817-156761839 AGGGGGAAGGAAGGGAGGGAAGG + Intergenic
1017721189 6:157244213-157244235 AGGGGGAAGGAGAGGAGGGAAGG - Intergenic
1017727494 6:157285639-157285661 AGCGGGAAGAAGGGCAGGGCAGG - Intergenic
1017764024 6:157592690-157592712 AGGGGGAAGGAGGAAAAGGGCGG + Intronic
1017930013 6:158943836-158943858 AGAGGGAAGAAAGAAAGGGAAGG - Intergenic
1018050357 6:160004184-160004206 ATCGGGAAGTAGGACAGGAAGGG + Intronic
1018208902 6:161461304-161461326 AGGGGGATGGTGGAGAGGGAGGG + Intronic
1018509135 6:164506269-164506291 AGGGCAAGGCAGGGCAGGGAAGG - Intergenic
1018667175 6:166149296-166149318 AGGGGCAGGGAGGACAGGGAAGG + Intergenic
1018893045 6:167996180-167996202 AGGGGGGAGTGGGGCAGGGAAGG - Intergenic
1019322966 7:423960-423982 AGAGGGCAGCAGGACAGAGAGGG + Intergenic
1019339000 7:499466-499488 AGGGGGAACCAGGCCAGACAGGG + Intronic
1019463205 7:1172434-1172456 AGGGGGAAGCTGGGCAGGGAGGG - Intergenic
1019488236 7:1299243-1299265 AGGGGGACGCAGGCCTGGGCAGG - Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019774984 7:2906941-2906963 AGGGAGAAGCAAGGCAGGGAAGG - Intronic
1019779505 7:2931082-2931104 AGGGGGTTGCATCACAGGGAAGG - Intronic
1019878225 7:3834854-3834876 AGAGGGGACCAGGAAAGGGAGGG - Intronic
1020129052 7:5549180-5549202 AGAGGGAAGAAGGAGAGGGAAGG + Intronic
1020519924 7:9173069-9173091 AAGGGGAAGGATGAGAGGGAAGG - Intergenic
1021128263 7:16880067-16880089 AGGGGAAAGAAGGAAGGGGAAGG - Intronic
1021162895 7:17298544-17298566 GGGGGCAAGCAGGACGGGGCGGG + Intergenic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022123692 7:27335225-27335247 AGGGGGAAACAGGCCTGGGCAGG - Intergenic
1022278727 7:28883279-28883301 AGGGAGAAGAAAGAAAGGGAGGG - Intergenic
1022793890 7:33716650-33716672 GGAGGGAAGCAGGAGAGAGAAGG - Intergenic
1023089535 7:36604724-36604746 AGAGGGAAGCAGTCCAGGGCTGG - Intronic
1023302195 7:38784655-38784677 AGGGGGAAGGAGGAGGGGAAGGG + Intronic
1023644347 7:42293668-42293690 AGGGGGAAGATGGAATGGGAGGG - Intergenic
1023991691 7:45132553-45132575 GGGAGGAAGGAGGAGAGGGAGGG + Intergenic
1024303338 7:47904626-47904648 TGGGGAAAGGAGGGCAGGGAAGG + Intronic
1024471106 7:49769563-49769585 AGAGGGAAGAAGGAAAGGAAGGG - Intergenic
1024512198 7:50213000-50213022 AGTGGGAGGCAGGCCAGGGCAGG + Intergenic
1025189602 7:56886610-56886632 AGGGGAAAGTGGGACAGGGTTGG + Intergenic
1025682338 7:63690307-63690329 AGGGGAAAGTGGGACAGGGTTGG - Intergenic
1026531081 7:71197905-71197927 AAGGGGATGCAGGCCAGGCACGG + Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026845560 7:73697184-73697206 TGGGGGCAGGAAGACAGGGATGG - Intronic
1026871069 7:73852204-73852226 GGAGGGAAGCAGGGAAGGGAGGG - Intergenic
1026890890 7:73981552-73981574 AGAGGGAGGGAGGAAAGGGAGGG + Intergenic
1026902804 7:74046372-74046394 TGGGGGGAGCAGGCCTGGGATGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027188184 7:75984040-75984062 AGGGGGAACCCCGACAGAGAGGG - Intronic
1027463513 7:78485516-78485538 AAGGAGAAACAGGACATGGATGG - Intronic
1027856847 7:83522547-83522569 TGGGGGGATCAGGACAAGGAAGG - Intronic
1028089412 7:86679657-86679679 AGGAGGAATGAGGACAGGAATGG - Intronic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028482098 7:91318064-91318086 AGAGGGAGGGAGAACAGGGAAGG + Intergenic
1028668526 7:93373749-93373771 AGTGGGAAGGAGGATAGGGATGG + Intergenic
1029058451 7:97771613-97771635 AGGGGAAAGCAGGGAAGGAAAGG + Intergenic
1029210908 7:98907794-98907816 TGGCTGAAGCAGGTCAGGGATGG - Intronic
1029210918 7:98907835-98907857 TGGCTGAAGCAGGTCAGGGAGGG - Intronic
1029269762 7:99370133-99370155 TGGGGGAGGCAGGCCAGGGCTGG - Intronic
1029436813 7:100568299-100568321 AGGCAGCAGCAGGACTGGGAGGG + Intergenic
1029540353 7:101179138-101179160 TGGGGGAGGGAGGAGAGGGAGGG + Intronic
1030274779 7:107709058-107709080 TGAGGGGAGCAGGATAGGGAAGG + Intronic
1031060708 7:117048225-117048247 AAGGGGAGGCAGGAGAGGCAGGG + Intronic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1031923167 7:127615759-127615781 TAAGGGAAGCAGGACAGGGCAGG + Intronic
1032089425 7:128903903-128903925 AGGGGGGCACAGGGCAGGGATGG + Intronic
1032151010 7:129429759-129429781 ATGGGCAAGTAGGATAGGGAGGG - Exonic
1032297621 7:130655551-130655573 AGAAGGAAGGAGGAGAGGGAGGG - Intronic
1032557630 7:132853871-132853893 ACTGGGGAGTAGGACAGGGAAGG + Intronic
1032782088 7:135171492-135171514 AGGGAGAAACAGAACAGGGCAGG - Intergenic
1032908121 7:136396137-136396159 AGGGAGGAGGAGGAGAGGGAAGG + Intergenic
1033602346 7:142897315-142897337 AGAGGGAAGCTGCAAAGGGAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034029129 7:147740825-147740847 CAATGGAAGCAGGACAGGGAAGG + Intronic
1034312304 7:150099591-150099613 AGAGGTGAGGAGGACAGGGATGG + Intergenic
1034339115 7:150341033-150341055 AGGGGGATTCTGGACGGGGAGGG - Exonic
1034442688 7:151094828-151094850 AGAGGGAAGGAGGGAAGGGAGGG - Intronic
1034457502 7:151179001-151179023 TGGAGGAGGCAGGACTGGGATGG - Intronic
1034494744 7:151412727-151412749 AGGTGGCTGCAGGACTGGGAAGG - Intergenic
1034794548 7:154001067-154001089 AGAGGTGAGGAGGACAGGGATGG - Intronic
1034814961 7:154164197-154164219 AGGGGACAGCAGGTCAGGGCAGG - Intronic
1034944930 7:155255671-155255693 AAGGGGAAGGGGGAGAGGGAGGG + Intergenic
1034951037 7:155297498-155297520 AGGCGGAGGCAGGACAGGGTGGG - Intergenic
1035031122 7:155861353-155861375 GGAGGGAGGCAGGGCAGGGACGG + Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035188031 7:157140956-157140978 AGAGGGAAGCTGGGTAGGGAAGG + Intronic
1035293915 7:157857163-157857185 AGGGGGACGCTGGAAGGGGAGGG + Intronic
1035389634 7:158496471-158496493 AGGGGGAAGGGGAGCAGGGAAGG - Intronic
1035389711 7:158496662-158496684 AGGGGGAAGGGGAGCAGGGAAGG - Intronic
1035389798 7:158496863-158496885 AGGGGGAGGGGGCACAGGGAAGG - Intronic
1035389929 7:158497174-158497196 AGGGGGAAGGGGTACAGGGAAGG - Intronic
1035433024 7:158836612-158836634 AGGGGGGAGCAAGAGAGAGAAGG - Intergenic
1035574577 8:696546-696568 ATGGGGAGGAAGGAGAGGGAGGG - Intronic
1035574655 8:696894-696916 ATGGGGAGGAAGGAGAGGGAGGG - Intronic
1035661022 8:1348856-1348878 AGGCACAAGCAGGACATGGATGG - Intergenic
1035918072 8:3646799-3646821 CAGGGGAAGCAAGACAGGGCTGG - Intronic
1036398536 8:8387747-8387769 TGGGGGAAGCTGTAGAGGGATGG + Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037103444 8:15076354-15076376 AGGGGGTAGCAAGAGAAGGATGG + Intronic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037945756 8:22988450-22988472 AGGGGGAAGGAGGTCAGGTGCGG - Intronic
1037987455 8:23298950-23298972 AGGGAGAAGCAGGGCAGAGGAGG + Intronic
1038170507 8:25127418-25127440 GGGGGGAAGGAAGAAAGGGAGGG + Intergenic
1038171199 8:25134458-25134480 ATGGGAAAGGTGGACAGGGAAGG + Intergenic
1038310289 8:26441117-26441139 AGGGGCAGGCGGGACAGGGGAGG + Intronic
1038421093 8:27434421-27434443 AGGGGGCAGGAGGAGAGGGCGGG + Intronic
1039047862 8:33466516-33466538 AGGGGAAAGAAGGGCAGGGCAGG + Intronic
1039420474 8:37433940-37433962 ATGGGGAAGGACTACAGGGAGGG + Intergenic
1039472020 8:37819271-37819293 CGTGGGCAGCAGGACAGGGATGG + Intronic
1039514963 8:38124964-38124986 GAGAGGAAGCAAGACAGGGAGGG + Intronic
1039611721 8:38924428-38924450 CTGGGGAAGGAGGACAGGGAAGG + Intronic
1039821370 8:41138328-41138350 ATGGGGAAGGGAGACAGGGAAGG + Intergenic
1040951385 8:52941204-52941226 AGCAGGGAGCAGGGCAGGGAGGG - Intergenic
1041132111 8:54712101-54712123 AGGGGAAACAAGGAGAGGGAAGG + Intergenic
1041559986 8:59206261-59206283 CTGGGGAAGCAGCTCAGGGATGG - Intergenic
1041784169 8:61612979-61613001 AGGGGCAAGAATGAAAGGGAAGG + Intronic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042666182 8:71209128-71209150 AGTGGCCAGCAGGGCAGGGATGG - Intronic
1042827512 8:72993594-72993616 TGGAGGAAGCAGGACAGGGAAGG + Intergenic
1042835335 8:73074767-73074789 AGAGGTAAGGAGGCCAGGGAGGG + Intronic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1042944738 8:74143982-74144004 TGGGGCAAGCGGCACAGGGAAGG + Intergenic
1043386016 8:79748602-79748624 TGGGGGCAGGAGGACAGAGAGGG - Intergenic
1043512144 8:80960125-80960147 AGGGCAAGGCAGGGCAGGGAAGG - Intergenic
1044163128 8:88945820-88945842 AGGGGCAGGCAGGAAAGGGCTGG - Intergenic
1044342814 8:91067050-91067072 AAGGGGAAACAGTGCAGGGAGGG + Intergenic
1044537201 8:93370852-93370874 AGGTGGAAAGAGGAGAGGGAAGG + Intergenic
1044661979 8:94600541-94600563 ATGGGAAAGCATGACAGTGAGGG + Intergenic
1044716834 8:95107478-95107500 GAGGGGTAGGAGGACAGGGAAGG + Intronic
1044767932 8:95597101-95597123 AGGGGGAGGGAGGGAAGGGAAGG - Intergenic
1045011092 8:97958938-97958960 AGAGGGAAGCAGGAGAGGCGTGG - Intronic
1045453241 8:102349569-102349591 AGGGGGAAAGAGGACAGGAAGGG + Intronic
1045557128 8:103225521-103225543 TGGAGGAAGCAGGGCAGGGCAGG + Intronic
1045906779 8:107355231-107355253 AGAGGGAAGCGGGAGAGGGATGG - Intronic
1046301169 8:112292719-112292741 ATGTGGCAGGAGGACAGGGAAGG + Intronic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047520837 8:125594284-125594306 AGGGTGGAGCAGAGCAGGGAAGG + Intergenic
1047701399 8:127452715-127452737 AGGGGGAAGGAAGAAAGGGAGGG + Intergenic
1047718782 8:127619792-127619814 AAGGGGAGGAAGGAGAGGGAAGG - Intergenic
1047734346 8:127752419-127752441 AGGGGAAAGTAGGTCAGGCATGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1047961932 8:130016992-130017014 AGGGGGAAGCGACCCAGGGATGG - Intronic
1048296150 8:133215614-133215636 GGGGGTGAGGAGGACAGGGAAGG - Intronic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048511507 8:135066500-135066522 TGAAGGAAGCAGGATAGGGAAGG + Intergenic
1048603800 8:135946834-135946856 AGAGAGAAGCAAGATAGGGAAGG + Intergenic
1048787810 8:138069529-138069551 ACGGGGAAGCAAGAAAGGGTGGG + Intergenic
1048915498 8:139178927-139178949 AGGGAGAAACAGAACAGGGCAGG + Intergenic
1048938205 8:139374540-139374562 CGAGGGAAGCAGCACAGGGCAGG + Intergenic
1049024576 8:139979801-139979823 AGGGGGACCCAGGACAGAGCTGG + Intronic
1049047663 8:140165585-140165607 AGGGGGAAGGAGGGAGGGGAAGG + Intronic
1049054755 8:140227144-140227166 AGGGGGCAGCTGCAGAGGGATGG + Intronic
1049124996 8:140778713-140778735 ATGGGGATGTAGGCCAGGGAAGG + Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049278130 8:141730131-141730153 TGTGGGAACCAGGAGAGGGATGG - Intergenic
1049477921 8:142805491-142805513 AGGGGGCATCAGGAAAGGGCAGG - Intergenic
1049852926 8:144843733-144843755 ATGAGGAAGCAGCACAAGGAGGG + Intronic
1050357744 9:4799016-4799038 AGGGGGAAAGAAGACAGGGAGGG - Intronic
1050368102 9:4891210-4891232 AGAGGGAAGGAAGAGAGGGAGGG - Intergenic
1050525613 9:6543874-6543896 AGGGGCAAGGAGGACAGGAGGGG + Intronic
1050536448 9:6634816-6634838 GGGGAGAAGCGGGAGAGGGAAGG - Intronic
1051150414 9:14073275-14073297 AGAGGGATAGAGGACAGGGAGGG - Intergenic
1051188046 9:14481363-14481385 ATGGGGAAGTGAGACAGGGAAGG - Intergenic
1051886580 9:21899414-21899436 AAGGGGAAGGAGGGGAGGGAAGG + Intronic
1052246168 9:26337755-26337777 ATGAGGAAGCAGGACAGAGAAGG - Intergenic
1052947302 9:34178845-34178867 AGGGGGAAGGAGGAAAGGAGGGG - Intergenic
1053019479 9:34685001-34685023 AGGGGCAGGCAGGGCAGGGTTGG - Intergenic
1053180874 9:35968967-35968989 AGGGGGAAGTAGAGAAGGGAGGG + Intergenic
1053199404 9:36142510-36142532 AGGAGAAAGCAGGCCCGGGATGG + Intronic
1053209934 9:36219146-36219168 TGGGGGTAGAAGGACTGGGAAGG - Intronic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053287906 9:36861737-36861759 AGGGGAGAGAAGGCCAGGGAGGG + Intronic
1053350802 9:37412154-37412176 AGTGGGAAGCAGGAGAGGGGAGG - Intergenic
1053420733 9:37975898-37975920 AAGTGGAAGCAGGAGAGGGGTGG + Intronic
1053462133 9:38279228-38279250 GAGTGGAAGCAGGAGAGGGAGGG - Intergenic
1053476970 9:38389156-38389178 AAGGGGAAGGAAGACAGAGAGGG + Intergenic
1053710384 9:40801157-40801179 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1054420292 9:64921946-64921968 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1054739466 9:68790063-68790085 AGGGGAAAGGAGGGGAGGGAAGG - Intronic
1054812691 9:69447329-69447351 AGAGGGAAGCTGGTTAGGGATGG - Intronic
1054909456 9:70440768-70440790 AAGGGGAGGAAGGAAAGGGAAGG + Intergenic
1055374491 9:75634367-75634389 AGAGGGAAGCAGTACTGGCAGGG - Intergenic
1055530505 9:77178194-77178216 AGGGGGGCAAAGGACAGGGATGG - Intronic
1055653358 9:78430059-78430081 TGGAGGAAGCAGGACAGAAAAGG - Intergenic
1055786965 9:79881556-79881578 GGGGGGAAGAAGGAGAGGGGAGG - Intergenic
1055799477 9:80018630-80018652 AGAGGAAAGCAAGACAGAGAAGG + Intergenic
1056137767 9:83646631-83646653 AGAGGGAAGGGGGAAAGGGAAGG + Intergenic
1056163157 9:83918325-83918347 GGGGGGGGGCAGGACAGGGAGGG + Intronic
1056258415 9:84823983-84824005 ATGGGGAAGCAGGACAGTGGGGG + Intronic
1056456268 9:86763956-86763978 AAGGGGAAGTAGAAAAGGGAAGG + Intergenic
1056463049 9:86826602-86826624 AGGGAGAAGCAGGAAAGAAAAGG - Intergenic
1057226695 9:93296558-93296580 AGGGGGAAGAAGGTAAGGGGAGG - Intronic
1057231969 9:93326713-93326735 AGGAGGAAGCAGGAGTGAGAAGG + Intronic
1057292776 9:93818087-93818109 AGGGGGAAGGAGTGAAGGGAAGG + Intergenic
1057311946 9:93948449-93948471 AGGGGAATCCAGAACAGGGAAGG + Intergenic
1057413893 9:94844631-94844653 ATGGGGAGGAAGGACAGGAAAGG - Intronic
1057863610 9:98662027-98662049 TGTGGGAAGCAGGACTGGAAGGG - Intronic
1057931284 9:99195832-99195854 AGGAGGAAGGAAGACAGGAAGGG - Intergenic
1057954627 9:99397750-99397772 AGGGGGTGGGAGGAAAGGGAAGG - Intergenic
1058045685 9:100354307-100354329 AGGGGGAAGAAGGACAATAAGGG - Intergenic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058440271 9:105000349-105000371 TGAGGGCAGCAGGACAGGGAAGG - Intergenic
1058818275 9:108705502-108705524 AGGGGGAACAAGGATAGAGAAGG - Intergenic
1059072481 9:111153024-111153046 AGGAGGAAGAAGGAAAGGAAAGG + Intergenic
1059396137 9:114035266-114035288 AGGGCAAGGCAGGGCAGGGAAGG + Intronic
1059411377 9:114134526-114134548 AAAGGGGAGCAGGAGAGGGAAGG + Intergenic
1059428726 9:114237149-114237171 GGGGGCAAGCAGGGCAGGGCAGG + Intronic
1059456168 9:114401664-114401686 GTGGGGAAGCAGGACAGGGAAGG - Intergenic
1059589885 9:115647366-115647388 AGGAGGAGGCAGGAAATGGAAGG - Intergenic
1059851400 9:118345203-118345225 AGGGTGAAGCAGGAGAGAGAAGG + Intergenic
1060058213 9:120434325-120434347 GAGGGGAAGCAGGAGAGGGTGGG + Intronic
1060477842 9:123999338-123999360 AGAAGGAAGCCGGAGAGGGAGGG + Intergenic
1060532211 9:124354565-124354587 AGCAGGAAGCAGAACAAGGAGGG + Intronic
1060539447 9:124419795-124419817 TGGGGGCAGCCGGGCAGGGATGG + Intergenic
1060866895 9:127007659-127007681 AAGAGAAAGCAAGACAGGGAGGG + Intronic
1061209191 9:129181076-129181098 ATGGGGAAACAGGGCAGGGATGG + Intergenic
1061253124 9:129437918-129437940 TGGCGGAAGGAGGACAAGGAAGG + Intergenic
1061281687 9:129601353-129601375 AGGGGGAAGAAGGAGAGAGGAGG + Intergenic
1061391047 9:130317130-130317152 AGGGGGAAGCAGGGGTGGGGTGG + Intronic
1061394802 9:130338046-130338068 AGGGTGATGGGGGACAGGGAGGG - Intronic
1061412413 9:130428752-130428774 AGAGGGAGCCAGGTCAGGGATGG + Intronic
1061595196 9:131624463-131624485 AGAGGGGAGAAGGAAAGGGAGGG - Intronic
1061821214 9:133228104-133228126 TGGGGGCTGCAGGCCAGGGAAGG - Intergenic
1061834230 9:133318260-133318282 TGGGGGCTGCAGGCCAGGGAAGG + Intergenic
1061942617 9:133891599-133891621 AGGGGAAAGAAGGAGAGGGATGG + Intronic
1062182262 9:135196758-135196780 AGTGGGAAGAAGAAGAGGGAAGG - Intergenic
1062254187 9:135613416-135613438 AGGAGGAAGGAGGGCAGGGCGGG + Intergenic
1062355804 9:136161717-136161739 AGGGGCAAGGAGGGGAGGGAAGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469712 9:136697026-136697048 AGGGGGGAGGAGGAGGGGGAAGG - Intergenic
1062469722 9:136697045-136697067 AGGGGGGAGGAGGAGGGGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062493235 9:136818852-136818874 AGGGTGAAGCTGGACAGTCAAGG + Intronic
1062503249 9:136860187-136860209 TGGGAGAGGCAGGGCAGGGAGGG - Intronic
1062547143 9:137068989-137069011 GTGGGGGAGCAGTACAGGGAGGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1185464365 X:346090-346112 AGGGGGGAGGAGGGAAGGGAAGG + Intronic
1185485976 X:481959-481981 AGAGGGAGGAAGGAGAGGGAGGG + Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185589845 X:1268749-1268771 ATGAGGAAGCAGGGGAGGGAGGG + Intergenic
1185593319 X:1292770-1292792 AGGGGCAGGCAGGAGACGGAGGG + Intronic
1186069961 X:5808805-5808827 AGGAAGCAGCAGGAGAGGGAGGG - Intergenic
1186430098 X:9497879-9497901 AGGAGGAAGGAGGGGAGGGAGGG - Intronic
1186532603 X:10312415-10312437 AGGGGGGAGAGGGAGAGGGAGGG - Intergenic
1186747209 X:12582523-12582545 GGAGGGAGGCAGGACAGGGAAGG + Intronic
1187102415 X:16207637-16207659 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1187396981 X:18927382-18927404 AAAGGGAAGGAGTACAGGGATGG + Intronic
1187401789 X:18966849-18966871 AGCGGGGAGAAGTACAGGGAAGG + Intronic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1187716134 X:22104364-22104386 AGGGGGTAGGTGGCCAGGGAGGG + Intronic
1187718549 X:22128420-22128442 TGGGAGATGCTGGACAGGGAGGG + Intronic
1187722432 X:22165325-22165347 TGGGAGAAGCAAGACAGGGAGGG + Intronic
1187985400 X:24805131-24805153 AGGGGGAAACAGGAAAGGGGTGG - Intronic
1188291409 X:28393154-28393176 AGTTGGAAGCAGGCCAGGCACGG - Intergenic
1188581871 X:31723749-31723771 AGAAGGAAGCTGGAGAGGGAAGG - Intronic
1188652141 X:32644597-32644619 TGGAGGAAAAAGGACAGGGAAGG + Intronic
1188920534 X:35971205-35971227 TGAGGGAAGCAGAATAGGGAAGG + Intronic
1189099329 X:38172659-38172681 TGAGGAAAGCAGAACAGGGAAGG + Intronic
1189131377 X:38501393-38501415 TGAGGGAAGCAGGAAAGGCAGGG - Intronic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189217524 X:39339366-39339388 AGTGGGAAGTGAGACAGGGAAGG - Intergenic
1189244190 X:39550570-39550592 TGAGGGAAGCAGGAGAGGGCAGG + Intergenic
1189289098 X:39872753-39872775 AGGGAGAAGGAGGACAAAGAAGG - Intergenic
1189383156 X:40516265-40516287 ATAGGGAAGCGAGACAGGGAAGG - Intergenic
1189728262 X:43990667-43990689 TGAGGGAAGCAGGATAGAGAAGG - Intergenic
1190060875 X:47211011-47211033 AGGAGAAGGCAGGGCAGGGAAGG - Intronic
1190198074 X:48336705-48336727 AGGGGGAGGAAGGGGAGGGAGGG + Intergenic
1190236075 X:48616768-48616790 AGGAGGAAGCAGGATCGGGCAGG + Intergenic
1190913813 X:54795044-54795066 AGGTGGGAGCAGGACAGTGGTGG - Intronic
1190927977 X:54925743-54925765 TGGGGGAAGTAGGACAAAGAAGG - Intronic
1192043400 X:67646334-67646356 AGGGTGAGGCTGGGCAGGGAGGG + Intronic
1192199899 X:69060236-69060258 AGAGGGAAGGGGGAAAGGGAGGG + Intergenic
1192433111 X:71125877-71125899 AGAGGGAAACAGGGAAGGGAGGG - Intronic
1192448972 X:71230923-71230945 AGGGGGAAGGGGGGAAGGGAGGG + Intergenic
1192552985 X:72068808-72068830 AAGGCAAAGCAGGAGAGGGAGGG + Intergenic
1193337330 X:80306480-80306502 AAGGGGAAGGAAGACTGGGAAGG - Intergenic
1193696525 X:84713378-84713400 AGGGAGATACAGGAGAGGGAAGG - Intergenic
1193794157 X:85852697-85852719 GACGGGAAGCAGTACAGGGATGG - Intergenic
1194411279 X:93561736-93561758 AAGAGGAAGAAGGACAGGGAAGG - Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1194788780 X:98119323-98119345 AGGGGGAAGGAAGAGTGGGAAGG + Intergenic
1195801492 X:108716697-108716719 AGGGAGAATCATAACAGGGAGGG + Intergenic
1195852345 X:109296549-109296571 AGGAGTAAGGAGGACAGGGAGGG + Intergenic
1196273330 X:113737445-113737467 AGGGGGAAGCAGTAAAATGATGG - Intergenic
1197181570 X:123542327-123542349 AGGGTGAAGCAGGCCAGGCCTGG - Intergenic
1197724153 X:129765135-129765157 AAGGGGCAGCGGGGCAGGGAAGG - Intronic
1197724471 X:129767560-129767582 CCGGGTAAGCAGGACAGTGAGGG - Intronic
1197880265 X:131159009-131159031 TTGGGGAAGCAAGACAAGGATGG - Intergenic
1197899572 X:131355704-131355726 AGGGAAAAGCAGGGAAGGGAAGG - Intronic
1198319955 X:135510856-135510878 TGAGGGAAGCAGGATAGGGCAGG + Intergenic
1199295533 X:146153605-146153627 AGAAGGAAGCAGGACAGGAAAGG - Intergenic
1199324207 X:146477225-146477247 AAGGAGCAGCATGACAGGGAGGG + Intergenic
1199474503 X:148230954-148230976 AGAGGGGAGAAGGAGAGGGAGGG - Intergenic
1199669137 X:150127531-150127553 AGGGGGTAGCAGGAATGGGGAGG - Intergenic
1199719104 X:150529377-150529399 CTGGGGAAGCAGTGCAGGGAAGG + Intergenic
1200062060 X:153488149-153488171 AGAGGGACAGAGGACAGGGACGG - Intronic
1200117680 X:153776505-153776527 AGGGCGAGGCAGGGCAGGGCGGG + Intronic
1200145473 X:153924165-153924187 TGGGGGAAGCAGGGCAGGGCAGG - Intronic
1200583846 Y:4982464-4982486 AGGATTGAGCAGGACAGGGAAGG - Intergenic
1201341107 Y:12935517-12935539 GGAGGGAAGGAGGAAAGGGAAGG - Intergenic
1201451121 Y:14116123-14116145 AGAGGGAAGGAGGAGAGGGGAGG + Intergenic